Transcript: Human NM_001287533.2

Homo sapiens zinc finger protein 92 (ZNF92), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
ZNF92 (168374)
Length:
3287
CDS:
494..2026

Additional Resources:

NCBI RefSeq record:
NM_001287533.2
NBCI Gene record:
ZNF92 (168374)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430830 ACTACTGACAGCAAGATATTT pLKO_005 680 CDS 100% 15.000 10.500 N ZNF92 n/a
2 TRCN0000429266 GAATATGACAAGGACTTTAAA pLKO_005 2102 3UTR 100% 15.000 10.500 N ZNF92 n/a
3 TRCN0000419548 CACTGAAGGGAAATCCTACAA pLKO_005 1774 CDS 100% 4.950 3.465 N ZNF92 n/a
4 TRCN0000019027 CCCTTACTGAACATAAGATAA pLKO.1 1497 CDS 100% 13.200 7.920 N ZNF92 n/a
5 TRCN0000019026 CGGTCCTCAAATCTTACTAAA pLKO.1 983 CDS 100% 13.200 7.920 N ZNF92 n/a
6 TRCN0000019025 GCCTTTAACAAATCCTCAAAT pLKO.1 1979 CDS 100% 13.200 7.920 N ZNF92 n/a
7 TRCN0000417793 TACTAAAGAGAAACTACAAAC pLKO_005 2002 CDS 100% 10.800 6.480 N ZNF92 n/a
8 TRCN0000019024 GCCTTTAACCAGTTCTCGATT pLKO.1 1142 CDS 100% 4.950 2.970 N ZNF92 n/a
9 TRCN0000017585 CAGAAGAGAAACCCTACAAAT pLKO.1 1104 CDS 100% 13.200 6.600 Y ZNF493 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1020 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1020 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1020 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000019028 GCCTTTAACCAGTCCTCAATT pLKO.1 1730 CDS 100% 13.200 6.600 Y ZNF92 n/a
14 TRCN0000435505 ACCCTACAAATGTGATGAATG pLKO_005 1366 CDS 100% 10.800 5.400 Y ZNF678 n/a
15 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 239 5UTR 100% 4.950 2.475 Y ZNF493 n/a
16 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 281 5UTR 100% 4.050 2.025 Y ZNF273 n/a
17 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1389 CDS 100% 4.950 2.475 Y ZNF714 n/a
18 TRCN0000264189 CAAGTAGCTGGGACTACAGGA pLKO_005 473 5UTR 100% 2.640 1.320 Y LINC01098 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287533.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09774 pDONR223 100% 98.5% 98.4% None 0_1ins21;1247A>G n/a
2 ccsbBroad304_09774 pLX_304 0% 98.5% 98.4% V5 0_1ins21;1247A>G n/a
3 TRCN0000472815 CCTGACTCCCTTTAAGTGTTCGTG pLX_317 27.4% 98.5% 98.4% V5 0_1ins21;1247A>G n/a
4 ccsbBroadEn_15278 pDONR223 59.5% 86.4% 86.1% None (many diffs) n/a
5 ccsbBroad304_15278 pLX_304 0% 86.4% 86.1% V5 (many diffs) n/a
6 ccsbBroadEn_11550 pDONR223 100% 70.8% 61% None (many diffs) n/a
7 ccsbBroad304_11550 pLX_304 0% 70.8% 61% V5 (many diffs) n/a
8 ccsbBroadEn_09784 pDONR223 100% 65.2% 55.9% None (many diffs) n/a
9 ccsbBroad304_09784 pLX_304 0% 65.2% 55.9% V5 (many diffs) n/a
10 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 65.2% 55.9% V5 (many diffs) n/a
11 ccsbBroadEn_15167 pDONR223 53.6% 64.4% 21.8% None (many diffs) n/a
12 ccsbBroad304_15167 pLX_304 0% 64.4% 21.8% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_10024 pDONR223 100% 63.6% 54.2% None (many diffs) n/a
14 ccsbBroad304_10024 pLX_304 0% 63.6% 54.2% V5 (many diffs) n/a
15 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 63.6% 54.2% V5 (many diffs) n/a
16 ccsbBroadEn_15273 pDONR223 50.9% 60% 50.3% None (many diffs) n/a
17 ccsbBroad304_15273 pLX_304 0% 60% 50.3% V5 (many diffs) n/a
18 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 20.8% 17.3% V5 (not translated due to frame shift) (many diffs) n/a
19 ccsbBroadEn_07157 pDONR223 100% 54.7% 45.9% None (many diffs) n/a
20 ccsbBroad304_07157 pLX_304 0% 54.7% 45.9% V5 (many diffs) n/a
21 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 54.7% 45.9% V5 (many diffs) n/a
Download CSV