Transcript: Human NM_001892.6

Homo sapiens casein kinase 1 alpha 1 (CSNK1A1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
CSNK1A1 (1452)
Length:
5360
CDS:
476..1489

Additional Resources:

NCBI RefSeq record:
NM_001892.6
NBCI Gene record:
CSNK1A1 (1452)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001892.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220643 CATCTATTTGGCGATCAACAT pLKO.1 565 CDS 100% 4.950 6.930 N CSNK1A1 n/a
2 TRCN0000342505 CATCTATTTGGCGATCAACAT pLKO_005 565 CDS 100% 4.950 6.930 N CSNK1A1 n/a
3 TRCN0000196287 GCAAGCTCTATAAGATTCTTC pLKO.1 657 CDS 100% 4.950 6.930 N CSNK1A1 n/a
4 TRCN0000342454 GCAAGCTCTATAAGATTCTTC pLKO_005 657 CDS 100% 4.950 6.930 N CSNK1A1 n/a
5 TRCN0000194651 CCTTGCTGACTCACTATTAAA pLKO.1 2392 3UTR 100% 15.000 10.500 N CSNK1A1 n/a
6 TRCN0000199766 GACTAGCAGCTGGACTGATTT pLKO.1 2664 3UTR 100% 13.200 9.240 N CSNK1A1 n/a
7 TRCN0000196743 GCATCTAAAGTGAAGACTTAA pLKO.1 2092 3UTR 100% 13.200 9.240 N CSNK1A1 n/a
8 TRCN0000199260 CCCGATATGCTAGCATCAATG pLKO.1 1029 CDS 100% 10.800 7.560 N CSNK1A1 n/a
9 TRCN0000220641 GCAGAATTTGCGATGTACTTA pLKO.1 1235 CDS 100% 5.625 3.938 N CSNK1A1 n/a
10 TRCN0000342507 GCAGAATTTGCGATGTACTTA pLKO_005 1235 CDS 100% 5.625 3.938 N CSNK1A1 n/a
11 TRCN0000220642 CAAGAGTAACATGAAAGGTTT pLKO.1 1465 CDS 100% 4.950 3.465 N CSNK1A1 n/a
12 TRCN0000199710 GCCACAGTTGTGATGGTTGTT pLKO.1 1889 3UTR 100% 4.950 3.465 N CSNK1A1 n/a
13 TRCN0000342508 GCCACAGTTGTGATGGTTGTT pLKO_005 1889 3UTR 100% 4.950 3.465 N CSNK1A1 n/a
14 TRCN0000010990 GCCTGCTTAATTGTGCTAGAA pLKO.1 2065 3UTR 100% 4.950 3.465 N CSNK1A1 n/a
15 TRCN0000023794 GCGTCACTGTAATAAGTTATT pLKO.1 916 CDS 100% 13.200 7.920 N Csnk1a1 n/a
16 TRCN0000276637 GCGTCACTGTAATAAGTTATT pLKO_005 916 CDS 100% 13.200 7.920 N Csnk1a1 n/a
17 TRCN0000196790 GATAACTTCCTAATGGGTATT pLKO.1 893 CDS 100% 10.800 6.480 N CSNK1A1 n/a
18 TRCN0000220644 GAATTCATTGTCGGAGGGAAA pLKO.1 503 CDS 100% 0.000 0.000 N CSNK1A1 n/a
19 TRCN0000196509 GACTACAATGTACTAGTCATG pLKO.1 725 CDS 100% 0.000 0.000 N CSNK1A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001892.6, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489949 GCATCGCACCCAACTGGGATACTC pLX_317 39.7% 99.9% 99.7% V5 1011_1012insG n/a
2 ccsbBroadEn_06055 pDONR223 100% 99.9% 99.7% None 691C>A n/a
3 ccsbBroad304_06055 pLX_304 66.4% 99.9% 99.7% V5 691C>A n/a
4 TRCN0000477459 AATTTCCATTAGTCTTCCTTATAA pLX_317 42.5% 99.9% 99.7% V5 691C>A n/a
5 TRCN0000488414 CCCTCATTAATCGTGTGGTTAAAT pLX_317 34.4% 99.9% 99.7% V5 (not translated due to prior stop codon) 988A>T n/a
6 TRCN0000492345 TCCACGATCACCACTAATTCCGCC pLX_317 46% 99.9% 99.7% V5 (not translated due to prior stop codon) 850C>T n/a
7 TRCN0000489092 CTTCAAACAGAGGGAACCCCTATC pLX_317 35.2% 99.8% 99.4% V5 850C>T;1011_1012insG n/a
8 ccsbBroad304_14599 pLX_304 66.1% 99.5% 22.5% V5 (not translated due to prior stop codon) 226_226delAinsCAN;229_230delCGinsNN n/a
9 TRCN0000473547 CTCATCCGGTGCGATGATGCCAAA pLX_317 42.4% 99.4% 22.5% V5 (not translated due to prior stop codon) 226_226delAinsCAN;229_230delCGinsNN;414_415insC n/a
10 ccsbBroadEn_14599 pDONR223 100% 99% 22.5% None (many diffs) n/a
11 ccsbBroadEn_09471 pDONR223 100% 91.6% 91% None (many diffs) n/a
12 ccsbBroad304_09471 pLX_304 0% 91.6% 91% V5 (many diffs) n/a
13 TRCN0000479467 AACCGTGTACGGGCCCCCAACCGA pLX_317 39.4% 91.6% 91% V5 (many diffs) n/a
14 ccsbBroadEn_15232 pDONR223 0% 91.6% 91% None (many diffs) n/a
15 ccsbBroad304_15232 pLX_304 0% 91.6% 91% V5 (many diffs) n/a
16 TRCN0000479515 GTCTGAATTAGTTATATTGCCGTG pLX_317 36.9% 91.6% 91% V5 (many diffs) n/a
17 TRCN0000488459 AGGGTACAACTCATGCCAATTGTA pLX_317 28.3% 91.6% 91% V5 (not translated due to prior stop codon) (many diffs) n/a
18 TRCN0000489911 TACCACATCGATAAACGCTCGCAG pLX_317 34.5% 91.6% 90.8% V5 (many diffs) n/a
Download CSV