Transcript: Human NM_020855.3

Homo sapiens zinc finger protein 492 (ZNF492), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF492 (57615)
Length:
4246
CDS:
245..1840

Additional Resources:

NCBI RefSeq record:
NM_020855.3
NBCI Gene record:
ZNF492 (57615)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_020855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000236657 ATTCCAGAGAGTTCATATTAA pLKO_005 2356 3UTR 100% 15.000 10.500 N ZNF492 n/a
2 TRCN0000236658 ACTAACATCTGTAGTACTAAT pLKO_005 3865 3UTR 100% 13.200 9.240 N ZNF492 n/a
3 TRCN0000236656 ACTCAAATTACTTCGTGTTAA pLKO_005 2682 3UTR 100% 13.200 9.240 N ZNF492 n/a
4 TRCN0000236660 TGATAAGAGGCATACAATATG pLKO_005 4023 3UTR 100% 13.200 7.920 N ZNF492 n/a
5 TRCN0000236659 TTCAATCAAGTCACATTATTC pLKO_005 3445 3UTR 100% 13.200 7.920 N ZNF492 n/a
6 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 876 CDS 100% 13.200 6.600 Y ZNF98 n/a
7 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1128 CDS 100% 13.200 6.600 Y ZNF98 n/a
8 TRCN0000236732 CCCTTACTGCACATAAGATAA pLKO_005 1044 CDS 100% 13.200 6.600 Y ZNF98 n/a
9 TRCN0000243748 CTGGAAAGAAACCCTACAAAT pLKO_005 819 CDS 100% 13.200 6.600 Y Gm6871 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 987 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 987 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 987 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000236733 TCACACTTAGCTCAACATAAA pLKO_005 704 CDS 100% 13.200 6.600 Y ZNF98 n/a
14 TRCN0000149130 GCTGGAGAGAAACCTTACAAA pLKO.1 1070 CDS 100% 5.625 2.813 Y ZNF761 n/a
15 TRCN0000016516 CCCTTACTACACATAAGAGAA pLKO.1 1296 CDS 100% 4.950 2.475 Y ZNF117 n/a
16 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3541 3UTR 100% 4.950 2.475 Y ERAP2 n/a
17 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 244 5UTR 100% 4.950 2.475 Y ZNF493 n/a
18 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 3542 3UTR 100% 13.200 6.600 Y LIAS n/a
19 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1076 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_020855.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09655 pDONR223 100% 99% 97.7% None (many diffs) n/a
2 ccsbBroad304_09655 pLX_304 0% 99% 97.7% V5 (many diffs) n/a
3 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 99% 97.7% V5 (many diffs) n/a
4 ccsbBroadEn_09784 pDONR223 100% 73.5% 61.6% None (many diffs) n/a
5 ccsbBroad304_09784 pLX_304 0% 73.5% 61.6% V5 (many diffs) n/a
6 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 73.5% 61.6% V5 (many diffs) n/a
7 ccsbBroadEn_15167 pDONR223 53.6% 73.1% 28.1% None (many diffs) n/a
8 ccsbBroad304_15167 pLX_304 0% 73.1% 28.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_08635 pDONR223 100% 69.5% 58.9% None (many diffs) n/a
10 ccsbBroad304_08635 pLX_304 0% 69.5% 58.9% V5 (many diffs) n/a
11 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 54.1% 44.7% V5 (many diffs) n/a
12 ccsbBroadEn_15273 pDONR223 50.9% 69% 58.6% None (many diffs) n/a
13 ccsbBroad304_15273 pLX_304 0% 69% 58.6% V5 (many diffs) n/a
14 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 28.5% 24% V5 (not translated due to frame shift) (many diffs) n/a
15 ccsbBroadEn_02188 pDONR223 100% 67.4% 60.2% None (many diffs) n/a
16 ccsbBroad304_02188 pLX_304 0% 67.4% 60.2% V5 (many diffs) n/a
17 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 67.4% 60.2% V5 (many diffs) n/a
Download CSV