Transcript: Human NM_201284.2

Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
EGFR (1956)
Length:
2872
CDS:
262..2379

Additional Resources:

NCBI RefSeq record:
NM_201284.2
NBCI Gene record:
EGFR (1956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001149231 GTCTGCGTACTTCCAGACCA pXPR_003 GGG 1819 86% 15 0.4319 EGFR EGFR 75690
2 BRDN0001149464 TGTCACCACATAATTACCTG pXPR_003 GGG 889 42% 8 0.2605 EGFR EGFR 75691
3 BRDN0001148919 TCTTGCCGGAATGTCAGCCG pXPR_003 AGG 1589 75% 13 0.0057 EGFR EGFR 75689
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_201284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000121069 CGCAAAGTGTGTAACGGAATA pLKO.1 1261 CDS 100% 10.800 15.120 N EGFR n/a
2 TRCN0000195303 CGCAAAGTGTGTAACGGAATA pLKO.1 1261 CDS 100% 10.800 15.120 N EGFR n/a
3 TRCN0000039636 CGCAAGTGTAAGAAGTGCGAA pLKO.1 1231 CDS 100% 2.640 3.696 N EGFR n/a
4 TRCN0000199100 CCACAGGAACTGGATATTCTG pLKO.1 1426 CDS 100% 4.950 3.960 N EGFR n/a
5 TRCN0000121204 CCTCCAGAGGATGTTCAATAA pLKO.1 411 CDS 100% 13.200 9.240 N EGFR n/a
6 TRCN0000295971 CCTCCAGAGGATGTTCAATAA pLKO_005 411 CDS 100% 13.200 9.240 N EGFR n/a
7 TRCN0000121328 TCTCCATAAATGCTACGAATA pLKO.1 1307 CDS 100% 10.800 7.560 N EGFR n/a
8 TRCN0000039637 GCAGTCTTATCTAACTATGAT pLKO.1 619 CDS 100% 5.625 3.938 N EGFR n/a
9 TRCN0000121331 GTGGCTGGTTATGTCCTCATT pLKO.1 514 CDS 100% 4.950 3.465 N EGFR n/a
10 TRCN0000121330 GAACATAACATCCTTGGGATT pLKO.1 1590 CDS 100% 4.050 2.835 N EGFR n/a
11 TRCN0000121205 AGAGGAAATATGTACTACGAA pLKO.1 583 CDS 100% 3.000 2.100 N EGFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_201284.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489587 TTCCGACATTAAGCCGCAACCGAG pLX_317 11.6% 56.5% 50.7% V5 (many diffs) n/a
2 TRCN0000491390 TACATTGGTATCCTAGTAACCCAG pLX_317 8.6% 56.5% 50.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000489590 AGGCTGCTTTATAAGACAGAGCAC pLX_317 11.8% 56.5% 50.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000491764 CACTCATGTCGTGGCCCAAAAAAT pLX_317 6.2% 56.5% 51% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14622 pDONR223 0% 56.5% 50.7% None (many diffs) n/a
6 TRCN0000470680 TTTCCTGTACTCAGTCAATTTGTA pLX_317 10.3% 56.5% 50.7% V5 (many diffs) n/a
7 ccsbBroad304_14622 pLX_304 25.5% 49% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489095 ACACCCGTTACCGGACACTAAACA pLX_317 9.2% 56.4% 51% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000488391 ACTAGCAATTCCGCAGTGTATGAG pLX_317 9.2% 56.3% 50.9% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000489511 CTCATTCCAAATATTCTTATAAAG pLX_317 10.6% 56.2% 52.7% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000487903 TTTGATCTATAGGTAATTAATTAT pLX_317 8.6% 56.2% 50.7% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000489889 TCAAGTATCAGACCACTAAACATC pLX_317 11.3% 56.2% 50.7% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_13848 pDONR223 100% 56.2% 50.1% None (many diffs) n/a
14 ccsbBroad304_13848 pLX_304 0% 56.2% 50.1% V5 (many diffs) n/a
15 TRCN0000475806 AGCGTCACAGGCTAACATACTCCG pLX_317 9.6% 56.2% 50.1% V5 (many diffs) n/a
Download CSV