Transcript: Human NM_203282.4

Homo sapiens zinc finger protein 254 (ZNF254), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
ZNF254 (9534)
Length:
4089
CDS:
122..2101

Additional Resources:

NCBI RefSeq record:
NM_203282.4
NBCI Gene record:
ZNF254 (9534)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203282.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000107876 ACCTCACCACAGATAAGATAA pLKO.1 2052 CDS 100% 13.200 9.240 N ZNF254 n/a
2 TRCN0000016343 GCACCTCACCACAGATAAGAT pLKO.1 2050 CDS 100% 5.625 3.938 N ZNF254 n/a
3 TRCN0000107877 CCCTTACTACACATGAAATAA pLKO.1 876 CDS 100% 15.000 9.000 N ZNF254 n/a
4 TRCN0000016344 CCCAGGTATGTGTCCTCATTT pLKO.1 370 CDS 100% 13.200 7.920 N ZNF254 n/a
5 TRCN0000016347 CCCTGGAATATGAAGCGACAT pLKO.1 332 CDS 100% 4.050 2.430 N ZNF254 n/a
6 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1826 CDS 100% 15.000 7.500 Y ZNF443 n/a
7 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1826 CDS 100% 15.000 7.500 Y Zfp97 n/a
8 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1212 CDS 100% 13.200 6.600 Y ZNF98 n/a
9 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1743 CDS 100% 13.200 6.600 Y ZNF138 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1155 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1155 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1155 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2289 3UTR 100% 5.625 2.813 Y ZNF254 n/a
14 TRCN0000018187 CCCAGAGCAAAGTATTTCAAT pLKO.1 567 CDS 100% 5.625 2.813 Y ZNF90 n/a
15 TRCN0000016346 CACTGGAGAGAAACCCTACAA pLKO.1 1153 CDS 100% 4.950 2.475 Y ZNF254 n/a
16 TRCN0000107878 CCCTAACTAAACATAAGAGAA pLKO.1 1968 CDS 100% 4.950 2.475 Y ZNF254 n/a
17 TRCN0000016345 CCTCAAATCTTACTACACATA pLKO.1 954 CDS 100% 4.950 2.475 Y ZNF254 n/a
18 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 274 CDS 100% 4.950 2.475 Y ZNF675 n/a
19 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 244 CDS 100% 4.950 2.475 Y ZNF493 n/a
20 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 286 CDS 100% 4.050 2.025 Y ZNF273 n/a
21 TRCN0000107879 CCACAGATAAGATAACTCATA pLKO.1 2058 CDS 100% 4.950 2.970 N ZNF254 n/a
22 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 824 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203282.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02188 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02188 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 100% 100% V5 n/a
4 ccsbBroadEn_09784 pDONR223 100% 70.1% 59.7% None (many diffs) n/a
5 ccsbBroad304_09784 pLX_304 0% 70.1% 59.7% V5 (many diffs) n/a
6 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 70.1% 59.7% V5 (many diffs) n/a
7 ccsbBroadEn_15167 pDONR223 53.6% 69.3% 29.6% None (many diffs) n/a
8 ccsbBroad304_15167 pLX_304 0% 69.3% 29.6% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_07157 pDONR223 100% 68% 58% None (many diffs) n/a
10 ccsbBroad304_07157 pLX_304 0% 68% 58% V5 (many diffs) n/a
11 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 68% 58% V5 (many diffs) n/a
12 ccsbBroadEn_15273 pDONR223 50.9% 65.1% 57% None (many diffs) n/a
13 ccsbBroad304_15273 pLX_304 0% 65.1% 57% V5 (many diffs) n/a
14 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 29.7% 25.5% V5 (not translated due to frame shift) (many diffs) n/a
15 ccsbBroadEn_11384 pDONR223 100% 13.5% 12.8% None (many diffs) n/a
16 ccsbBroad304_11384 pLX_304 0% 13.5% 12.8% V5 (many diffs) n/a
17 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 13.5% 12.8% V5 (many diffs) n/a
18 ccsbBroadEn_15729 pDONR223 0% 11% 10% None (many diffs) n/a
19 ccsbBroad304_15729 pLX_304 0% 11% 10% V5 (many diffs) n/a
20 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 11% 10% V5 (many diffs) n/a
21 ccsbBroadEn_13746 pDONR223 100% 10.9% 10.4% None (many diffs) n/a
22 ccsbBroad304_13746 pLX_304 0% 10.9% 10.4% V5 (many diffs) n/a
23 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 10.9% 10.4% V5 (many diffs) n/a
Download CSV