Transcript: Human NR_135912.2

Homo sapiens leucine rich repeat containing 6 (LRRC6), transcript variant 16, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
LRRC6 (23639)
Length:
4358
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_135912.2
NBCI Gene record:
LRRC6 (23639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_135912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429428 ACCAACTTACGTGCGAGTAAT pLKO_005 2078 3UTR 100% 13.200 18.480 N LRRC6 n/a
2 TRCN0000435091 CCCGATAGTAGTTCTGCTAAA pLKO_005 2145 3UTR 100% 10.800 15.120 N LRRC6 n/a
3 TRCN0000136287 GAACACAACGACTGTGTCATT pLKO.1 1018 3UTR 100% 0.495 0.693 N LRRC6 n/a
4 TRCN0000429948 CCTTGCTGTCTATAGGTATAT pLKO_005 2027 3UTR 100% 13.200 10.560 N LRRC6 n/a
5 TRCN0000428230 GACTAGAACACATTGATAAAT pLKO_005 1082 3UTR 100% 15.000 10.500 N LRRC6 n/a
6 TRCN0000138818 GCCCAAGGTAGGAGAAGTAAT pLKO.1 2201 3UTR 100% 13.200 9.240 N LRRC6 n/a
7 TRCN0000133817 CCTGTTTGTTTACTCCTGAAT pLKO.1 1825 3UTR 100% 4.950 3.465 N LRRC6 n/a
8 TRCN0000138915 GATCTCAGACAACGGGTCATT pLKO.1 2167 3UTR 100% 4.950 3.465 N LRRC6 n/a
9 TRCN0000134969 CTAAATGTGAATGAGCCCAAA pLKO.1 1962 3UTR 100% 4.050 2.835 N LRRC6 n/a
10 TRCN0000135525 CCTAAATGTGAATGAGCCCAA pLKO.1 1961 3UTR 100% 2.160 1.512 N LRRC6 n/a
11 TRCN0000134492 GACCTGACTGTGAATTTCATT pLKO.1 1571 3UTR 100% 5.625 3.375 N LRRC6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_135912.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02816 pDONR223 100% 25.5% None (many diffs) n/a
2 ccsbBroad304_02816 pLX_304 0% 25.5% V5 (many diffs) n/a
3 TRCN0000476467 CTCTATTTACGTGCGGGCTAACCG pLX_317 24.3% 25.5% V5 (many diffs) n/a
4 ccsbBroadEn_13781 pDONR223 100% 5.5% None (many diffs) n/a
5 ccsbBroad304_13781 pLX_304 0% 5.5% V5 (many diffs) n/a
6 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 5.5% V5 (many diffs) n/a
7 ccsbBroadEn_10792 pDONR223 100% 4.9% None (many diffs) n/a
8 ccsbBroad304_10792 pLX_304 0% 4.9% V5 (many diffs) n/a
9 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.9% V5 (many diffs) n/a
10 ccsbBroadEn_15487 pDONR223 0% 3.6% None (many diffs) n/a
11 ccsbBroad304_15487 pLX_304 0% 3.6% V5 (many diffs) n/a
12 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.6% V5 (many diffs) n/a
13 ccsbBroadEn_10261 pDONR223 100% 1.4% None (many diffs) n/a
14 ccsbBroad304_10261 pLX_304 0% 1.4% V5 (many diffs) n/a
15 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.4% V5 (many diffs) n/a
Download CSV