Transcript: Human XM_017026783.1

PREDICTED: Homo sapiens killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 1 (KIR2DL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIR2DL1 (3802)
Length:
1739
CDS:
644..1405

Additional Resources:

NCBI RefSeq record:
XM_017026783.1
NBCI Gene record:
KIR2DL1 (3802)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430647 CATCGTGATCATAGGTCTATA pLKO_005 1000 CDS 100% 13.200 6.600 Y KIR2DS1 n/a
2 TRCN0000057032 GTCACAGGAAACCCTTCAAAT pLKO.1 1301 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
3 TRCN0000446297 ACGACACTTTGCGCCTCATTG pLKO_005 843 CDS 100% 10.800 5.400 Y KIR2DL1 n/a
4 TRCN0000243132 CTATGACATGTACCATCTATC pLKO_005 1105 CDS 100% 10.800 5.400 Y KIR3DS1 n/a
5 TRCN0000057030 CCTATGACATGTACCATCTAT pLKO.1 1104 CDS 100% 5.625 2.813 Y KIR2DS2 n/a
6 TRCN0000056827 CCTCTGGACATCGTGATCATA pLKO.1 992 CDS 100% 5.625 2.813 Y KIR2DL1 n/a
7 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 1228 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
8 TRCN0000056929 GCTTGTTTCTGTCACAGGAAA pLKO.1 1291 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
9 TRCN0000056991 GCCTGGTGAAATCAGAAGAGA pLKO.1 753 CDS 100% 3.000 1.500 Y KIR2DS1 n/a
10 TRCN0000056988 GTCATGTTTGAACACTTCCTT pLKO.1 800 CDS 100% 3.000 1.500 Y KIR2DS1 n/a
11 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 1286 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
12 TRCN0000056992 CTTCTCCATCAGTCGCATGAA pLKO.1 895 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026783.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 76.5% 77.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 76.1% 76.6% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14687 pDONR223 73.4% 75.4% 75.9% None (many diffs) n/a
4 ccsbBroad304_14687 pLX_304 0% 75.4% 75.9% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_13888 pDONR223 100% 75.2% 5.9% None (many diffs) n/a
6 ccsbBroad304_13888 pLX_304 0% 75.2% 5.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 75.2% 5.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_13754 pDONR223 100% 70.5% 64.3% None (many diffs) n/a
9 ccsbBroad304_13754 pLX_304 0% 70.5% 64.3% V5 (many diffs) n/a
10 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 70.5% 64.3% V5 (many diffs) n/a
11 ccsbBroadEn_06487 pDONR223 100% 69.6% 62.9% None (many diffs) n/a
12 ccsbBroad304_06487 pLX_304 0% 69.6% 62.9% V5 (many diffs) n/a
13 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 69.6% 62.9% V5 (many diffs) n/a
14 ccsbBroadEn_10936 pDONR223 100% 66.6% 63.1% None (many diffs) n/a
15 ccsbBroad304_10936 pLX_304 0% 66.6% 63.1% V5 (many diffs) n/a
16 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 66.6% 63.1% V5 (many diffs) n/a
17 ccsbBroadEn_13889 pDONR223 100% 58.5% 43.6% None (many diffs) n/a
18 ccsbBroadEn_00908 pDONR223 100% 57.8% 51% None (many diffs) n/a
19 ccsbBroad304_00908 pLX_304 0% 57.8% 51% V5 (many diffs) n/a
20 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 57.8% 51% V5 (many diffs) n/a
21 ccsbBroadEn_06489 pDONR223 100% 51.2% 44.1% None (many diffs) n/a
22 ccsbBroad304_06489 pLX_304 0% 51.2% 44.1% V5 (many diffs) n/a
23 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 51.2% 44.1% V5 (many diffs) n/a
24 ccsbBroadEn_00907 pDONR223 100% 49% 43.7% None (many diffs) n/a
25 ccsbBroad304_00907 pLX_304 0% 49% 43.7% V5 (many diffs) n/a
26 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 49% 43.7% V5 (many diffs) n/a
Download CSV