Transcript: Human NM_001346897.2

Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 5, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
EGFR (1956)
Length:
3848
CDS:
262..3537

Additional Resources:

NCBI RefSeq record:
NM_001346897.2
NBCI Gene record:
EGFR (1956)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001346897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039635 CCCGTCGCTATCAAGGAATTA pLKO.1 2347 CDS 100% 13.200 18.480 N EGFR n/a
2 TRCN0000121069 CGCAAAGTGTGTAACGGAATA pLKO.1 1126 CDS 100% 10.800 15.120 N EGFR n/a
3 TRCN0000195303 CGCAAAGTGTGTAACGGAATA pLKO.1 1126 CDS 100% 10.800 15.120 N EGFR n/a
4 TRCN0000121203 GTCCGGGAACACAAAGACAAT pLKO.1 2530 CDS 100% 4.950 6.930 N EGFR n/a
5 TRCN0000039636 CGCAAGTGTAAGAAGTGCGAA pLKO.1 1096 CDS 100% 2.640 3.696 N EGFR n/a
6 TRCN0000199174 CCAAGCTCTCTTGAGGATCTT pLKO.1 2226 CDS 100% 4.950 3.960 N EGFR n/a
7 TRCN0000199100 CCACAGGAACTGGATATTCTG pLKO.1 1291 CDS 100% 4.950 3.960 N EGFR n/a
8 TRCN0000121204 CCTCCAGAGGATGTTCAATAA pLKO.1 411 CDS 100% 13.200 9.240 N EGFR n/a
9 TRCN0000295971 CCTCCAGAGGATGTTCAATAA pLKO_005 411 CDS 100% 13.200 9.240 N EGFR n/a
10 TRCN0000121328 TCTCCATAAATGCTACGAATA pLKO.1 1172 CDS 100% 10.800 7.560 N EGFR n/a
11 TRCN0000121071 CCGTGGCTTGCATTGATAGAA pLKO.1 3263 CDS 100% 5.625 3.938 N EGFR n/a
12 TRCN0000039637 GCAGTCTTATCTAACTATGAT pLKO.1 619 CDS 100% 5.625 3.938 N EGFR n/a
13 TRCN0000121329 CAGCATGTCAAGATCACAGAT pLKO.1 2671 CDS 100% 4.950 3.465 N EGFR n/a
14 TRCN0000039634 GCTGGATGATAGACGCAGATA pLKO.1 2975 CDS 100% 4.950 3.465 N EGFR n/a
15 TRCN0000298822 GCTGGATGATAGACGCAGATA pLKO_005 2975 CDS 100% 4.950 3.465 N EGFR n/a
16 TRCN0000121331 GTGGCTGGTTATGTCCTCATT pLKO.1 514 CDS 100% 4.950 3.465 N EGFR n/a
17 TRCN0000121330 GAACATAACATCCTTGGGATT pLKO.1 1455 CDS 100% 4.050 2.835 N EGFR n/a
18 TRCN0000121205 AGAGGAAATATGTACTACGAA pLKO.1 583 CDS 100% 3.000 2.100 N EGFR n/a
19 TRCN0000199532 GCCTATCAAGTGGATGGCATT pLKO.1 2754 CDS 100% 4.050 2.430 N EGFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001346897.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13848 pDONR223 100% 99.8% 99.8% None (many diffs) n/a
2 ccsbBroad304_13848 pLX_304 0% 99.8% 99.8% V5 (many diffs) n/a
3 TRCN0000475806 AGCGTCACAGGCTAACATACTCCG pLX_317 9.6% 99.8% 99.8% V5 (many diffs) n/a
4 TRCN0000487903 TTTGATCTATAGGTAATTAATTAT pLX_317 8.6% 88.9% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
5 TRCN0000491390 TACATTGGTATCCTAGTAACCCAG pLX_317 8.6% 88.9% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000489590 AGGCTGCTTTATAAGACAGAGCAC pLX_317 11.8% 88.9% 86.5% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489889 TCAAGTATCAGACCACTAAACATC pLX_317 11.3% 88.8% 86.4% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_14622 pDONR223 0% 88.8% 86.6% None (many diffs) n/a
9 TRCN0000470680 TTTCCTGTACTCAGTCAATTTGTA pLX_317 10.3% 88.8% 86.6% V5 (many diffs) n/a
10 ccsbBroad304_14622 pLX_304 25.5% 71% 24.4% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000489587 TTCCGACATTAAGCCGCAACCGAG pLX_317 11.6% 88.8% 86.6% V5 (many diffs) n/a
12 TRCN0000489511 CTCATTCCAAATATTCTTATAAAG pLX_317 10.6% 88.6% 90.2% V5 (not translated due to prior stop codon) (many diffs) n/a
13 TRCN0000488391 ACTAGCAATTCCGCAGTGTATGAG pLX_317 9.2% 88.5% 86.2% V5 (not translated due to prior stop codon) (many diffs) n/a
14 TRCN0000489095 ACACCCGTTACCGGACACTAAACA pLX_317 9.2% 88.4% 86% V5 (not translated due to prior stop codon) (many diffs) n/a
15 TRCN0000491764 CACTCATGTCGTGGCCCAAAAAAT pLX_317 6.2% 88.2% 85.9% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000488104 TATGTACGTCCGGGTACTGATTCC pLX_317 20.9% 37.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV