Transcript: Human NM_005228.5

Homo sapiens epidermal growth factor receptor (EGFR), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
EGFR (1956)
Length:
9905
CDS:
262..3894

Additional Resources:

NCBI RefSeq record:
NM_005228.5
NBCI Gene record:
EGFR (1956)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146570 GTGGAGCCTCTTACACCCAG pXPR_003 TGG 2081 57% 18 0.8099 EGFR EGFR 75688
2 BRDN0001149231 GTCTGCGTACTTCCAGACCA pXPR_003 GGG 1819 50% 15 0.4485 EGFR EGFR 75690
3 BRDN0001149464 TGTCACCACATAATTACCTG pXPR_003 GGG 889 24% 8 0.2138 EGFR EGFR 75691
4 BRDN0001148919 TCTTGCCGGAATGTCAGCCG pXPR_003 AGG 1589 44% 13 -0.0574 EGFR EGFR 75689
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_005228.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000039635 CCCGTCGCTATCAAGGAATTA pLKO.1 2482 CDS 100% 13.200 18.480 N EGFR n/a
2 TRCN0000121069 CGCAAAGTGTGTAACGGAATA pLKO.1 1261 CDS 100% 10.800 15.120 N EGFR n/a
3 TRCN0000195303 CGCAAAGTGTGTAACGGAATA pLKO.1 1261 CDS 100% 10.800 15.120 N EGFR n/a
4 TRCN0000121203 GTCCGGGAACACAAAGACAAT pLKO.1 2665 CDS 100% 4.950 6.930 N EGFR n/a
5 TRCN0000039636 CGCAAGTGTAAGAAGTGCGAA pLKO.1 1231 CDS 100% 2.640 3.696 N EGFR n/a
6 TRCN0000199174 CCAAGCTCTCTTGAGGATCTT pLKO.1 2361 CDS 100% 4.950 3.960 N EGFR n/a
7 TRCN0000199100 CCACAGGAACTGGATATTCTG pLKO.1 1426 CDS 100% 4.950 3.960 N EGFR n/a
8 TRCN0000121068 GCCACAAAGCAGTGAATTTAT pLKO.1 3864 CDS 100% 15.000 10.500 N EGFR n/a
9 TRCN0000295969 GCCACAAAGCAGTGAATTTAT pLKO_005 3864 CDS 100% 15.000 10.500 N EGFR n/a
10 TRCN0000121204 CCTCCAGAGGATGTTCAATAA pLKO.1 411 CDS 100% 13.200 9.240 N EGFR n/a
11 TRCN0000295971 CCTCCAGAGGATGTTCAATAA pLKO_005 411 CDS 100% 13.200 9.240 N EGFR n/a
12 TRCN0000195131 CATTGGATTCATCAGCATTTG pLKO.1 4740 3UTR 100% 10.800 7.560 N EGFR n/a
13 TRCN0000199387 CTGTGCAGAATCCTGTCTATC pLKO.1 3572 CDS 100% 10.800 7.560 N EGFR n/a
14 TRCN0000121067 GCTGCTCTGAAATCTCCTTTA pLKO.1 4903 3UTR 100% 10.800 7.560 N EGFR n/a
15 TRCN0000295968 GCTGCTCTGAAATCTCCTTTA pLKO_005 4903 3UTR 100% 10.800 7.560 N EGFR n/a
16 TRCN0000121328 TCTCCATAAATGCTACGAATA pLKO.1 1307 CDS 100% 10.800 7.560 N EGFR n/a
17 TRCN0000121071 CCGTGGCTTGCATTGATAGAA pLKO.1 3398 CDS 100% 5.625 3.938 N EGFR n/a
18 TRCN0000039637 GCAGTCTTATCTAACTATGAT pLKO.1 619 CDS 100% 5.625 3.938 N EGFR n/a
19 TRCN0000121206 GCCAAGCCAAATGGCATCTTT pLKO.1 3802 CDS 100% 5.625 3.938 N EGFR n/a
20 TRCN0000310112 GCCAAGCCAAATGGCATCTTT pLKO_005 3802 CDS 100% 5.625 3.938 N EGFR n/a
21 TRCN0000121329 CAGCATGTCAAGATCACAGAT pLKO.1 2806 CDS 100% 4.950 3.465 N EGFR n/a
22 TRCN0000039634 GCTGGATGATAGACGCAGATA pLKO.1 3110 CDS 100% 4.950 3.465 N EGFR n/a
23 TRCN0000298822 GCTGGATGATAGACGCAGATA pLKO_005 3110 CDS 100% 4.950 3.465 N EGFR n/a
24 TRCN0000121331 GTGGCTGGTTATGTCCTCATT pLKO.1 514 CDS 100% 4.950 3.465 N EGFR n/a
25 TRCN0000121070 CCACCAAATTAGCCTGGACAA pLKO.1 3747 CDS 100% 4.050 2.835 N EGFR n/a
26 TRCN0000121330 GAACATAACATCCTTGGGATT pLKO.1 1590 CDS 100% 4.050 2.835 N EGFR n/a
27 TRCN0000121205 AGAGGAAATATGTACTACGAA pLKO.1 583 CDS 100% 3.000 2.100 N EGFR n/a
28 TRCN0000121327 CCCATCCAATTTATCAAGGAA pLKO.1 5414 3UTR 100% 3.000 2.100 N EGFR n/a
29 TRCN0000121202 CCCTGTAACCTGACTGGTTAA pLKO.1 5344 3UTR 100% 1.080 0.756 N EGFR n/a
30 TRCN0000010329 GAGAATGTGGAATACCTAAGG pLKO.1 4779 3UTR 100% 4.050 2.430 N EGFR n/a
31 TRCN0000199532 GCCTATCAAGTGGATGGCATT pLKO.1 2889 CDS 100% 4.050 2.430 N EGFR n/a
32 TRCN0000039633 GCTGAGAATGTGGAATACCTA pLKO.1 4776 3UTR 100% 3.000 1.800 N EGFR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_005228.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14622 pDONR223 0% 99.9% 100% None 2709T>C n/a
2 TRCN0000470680 TTTCCTGTACTCAGTCAATTTGTA pLX_317 10.3% 99.9% 100% V5 2709T>C n/a
3 ccsbBroad304_14622 pLX_304 25.5% 81.4% 26.7% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000489587 TTCCGACATTAAGCCGCAACCGAG pLX_317 11.6% 99.9% 100% V5 2361G>A;2709T>C n/a
5 TRCN0000487903 TTTGATCTATAGGTAATTAATTAT pLX_317 8.6% 99.8% 99.9% V5 (not translated due to prior stop codon) (many diffs) n/a
6 TRCN0000491390 TACATTGGTATCCTAGTAACCCAG pLX_317 8.6% 99.8% 99.9% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000489590 AGGCTGCTTTATAAGACAGAGCAC pLX_317 11.8% 99.8% 99.9% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489889 TCAAGTATCAGACCACTAAACATC pLX_317 11.3% 99.8% 99.8% V5 (not translated due to prior stop codon) (many diffs) n/a
9 TRCN0000489511 CTCATTCCAAATATTCTTATAAAG pLX_317 10.6% 99.6% 91.3% V5 (not translated due to prior stop codon) (many diffs) n/a
10 TRCN0000488391 ACTAGCAATTCCGCAGTGTATGAG pLX_317 9.2% 99.5% 99.5% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000489095 ACACCCGTTACCGGACACTAAACA pLX_317 9.2% 99.4% 99.4% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000491764 CACTCATGTCGTGGCCCAAAAAAT pLX_317 6.2% 99.2% 99.3% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_13848 pDONR223 100% 88.8% 86.5% None (many diffs) n/a
14 ccsbBroad304_13848 pLX_304 0% 88.8% 86.5% V5 (many diffs) n/a
15 TRCN0000475806 AGCGTCACAGGCTAACATACTCCG pLX_317 9.6% 88.8% 86.7% V5 (many diffs) n/a
16 TRCN0000488104 TATGTACGTCCGGGTACTGATTCC pLX_317 20.9% 43.6% V5 (not translated due to prior stop codon) 1_2044del;2361G>A;2709T>C n/a
Download CSV