Transcript: Human NM_203287.2

Homo sapiens pregnancy specific beta-1-glycoprotein 11 (PSG11), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
PSG11 (5680)
Length:
1234
CDS:
98..739

Additional Resources:

NCBI RefSeq record:
NM_203287.2
NBCI Gene record:
PSG11 (5680)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_203287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000415382 TTCAATAATCCAACGTAGCAG pLKO_005 722 CDS 100% 2.640 3.696 N PSG11 n/a
2 TRCN0000430168 TCCATTTCATTGGACTAAATA pLKO_005 992 3UTR 100% 15.000 10.500 N PSG11 n/a
3 TRCN0000417451 CATAGGATGCAGCTGTCTGAA pLKO_005 302 CDS 100% 4.950 3.465 N PSG11 n/a
4 TRCN0000179853 CCAAAGCATAATGGGCTCTAT pLKO.1 608 CDS 100% 4.950 3.465 N PSG11 n/a
5 TRCN0000183407 CTCAGATTACTCCAAAGCATA pLKO.1 597 CDS 100% 4.950 3.465 N PSG11 n/a
6 TRCN0000438523 GCAAACTCTAACCCACCAGCA pLKO_005 518 CDS 100% 2.160 1.512 N PSG11 n/a
7 TRCN0000150153 GACTGTGATCTTAACCTGTAA pLKO.1 220 CDS 100% 4.950 2.970 N PSG11 n/a
8 TRCN0000147273 GCACAGTATTCTTGGACAATT pLKO.1 536 CDS 100% 13.200 6.600 Y PSG11 n/a
9 TRCN0000183422 CCTGATAACTTCAAGATCATA pLKO.1 893 3UTR 100% 5.625 2.813 Y PSG2 n/a
10 TRCN0000183406 CTTCAGCAATTGGTAAAGTAT pLKO.1 1099 3UTR 100% 5.625 2.813 Y PSG9 n/a
11 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 366 CDS 100% 4.950 2.475 Y PSG2 n/a
12 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 366 CDS 100% 4.950 2.475 Y PSG7 n/a
13 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 366 CDS 100% 4.950 2.475 Y PSG1 n/a
14 TRCN0000180534 GAAACCAACAGGACCCTCTTT pLKO.1 320 CDS 100% 4.950 2.475 Y PSG8 n/a
15 TRCN0000156722 GCAGGACCCTATGAATGTGAA pLKO.1 365 CDS 100% 4.950 2.475 Y PSG3 n/a
16 TRCN0000151218 GTTGCTTTGATTCTTCCTCAA pLKO.1 783 3UTR 100% 4.050 2.025 Y PSG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_203287.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06793 pDONR223 100% 96.9% 96.8% None 0_1insATGCACGCAGCAGAGATC;424A>G;504G>A n/a
2 ccsbBroad304_06793 pLX_304 0% 96.9% 96.8% V5 0_1insATGCACGCAGCAGAGATC;424A>G;504G>A n/a
3 TRCN0000475187 CAACATGAGCTAGTACCTTGAGAG pLX_317 68.6% 96.9% 96.8% V5 0_1insATGCACGCAGCAGAGATC;424A>G;504G>A n/a
4 ccsbBroadEn_13930 pDONR223 100% 58.6% 53.3% None (many diffs) n/a
5 ccsbBroad304_13930 pLX_304 0% 58.6% 53.3% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 58.6% 53.3% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_06790 pDONR223 100% 45.1% 39.9% None (many diffs) n/a
8 ccsbBroad304_06790 pLX_304 0% 45.1% 39.9% V5 (many diffs) n/a
9 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 45.1% 39.9% V5 (many diffs) n/a
10 ccsbBroadEn_05670 pDONR223 100% 44.3% 38.7% None (many diffs) n/a
11 ccsbBroad304_05670 pLX_304 0% 44.3% 38.7% V5 (many diffs) n/a
12 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 44.3% 38.7% V5 (many diffs) n/a
13 ccsbBroadEn_01306 pDONR223 100% 43.9% 38.3% None (many diffs) n/a
14 ccsbBroad304_01306 pLX_304 0% 43.9% 38.3% V5 (many diffs) n/a
15 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 43.9% 38.3% V5 (many diffs) n/a
16 ccsbBroadEn_11063 pDONR223 100% 43.5% 38.7% None (many diffs) n/a
17 ccsbBroad304_11063 pLX_304 0% 43.5% 38.7% V5 (many diffs) n/a
18 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 43.5% 38.7% V5 (many diffs) n/a
19 ccsbBroadEn_06792 pDONR223 100% 43.4% 36.8% None (many diffs) n/a
20 ccsbBroad304_06792 pLX_304 0% 43.4% 36.8% V5 (many diffs) n/a
21 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 43.4% 36.8% V5 (many diffs) n/a
22 ccsbBroadEn_01305 pDONR223 100% 42.3% 37.5% None (many diffs) n/a
23 ccsbBroad304_01305 pLX_304 0% 42.3% 37.5% V5 (many diffs) n/a
24 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 42.3% 37.5% V5 (many diffs) n/a
Download CSV