Transcript: Human NM_001323331.2

Homo sapiens mitogen-activated protein kinase 8 (MAPK8), transcript variant 17, mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
MAPK8 (5599)
Length:
6003
CDS:
389..1672

Additional Resources:

NCBI RefSeq record:
NM_001323331.2
NBCI Gene record:
MAPK8 (5599)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001056 GCCCAGTAATATAGTAGTAAA pLKO.1 847 CDS 100% 13.200 18.480 N MAPK8 n/a
2 TRCN0000001057 GTCTGGTATGATCCTTCTGAA pLKO.1 1355 CDS 100% 4.950 6.930 N MAPK8 n/a
3 TRCN0000001055 GAGTCGGTTAGTCATTGATAG pLKO.1 1706 3UTR 100% 10.800 8.640 N MAPK8 n/a
4 TRCN0000352709 GAGTCGGTTAGTCATTGATAG pLKO_005 1706 3UTR 100% 10.800 8.640 N MAPK8 n/a
5 TRCN0000055115 GCAAATCTTTGCCAAGTGATT pLKO.1 725 CDS 100% 4.950 3.960 N Mapk8 n/a
6 TRCN0000196820 GACCTAAATATGCTGGATATA pLKO.1 1176 CDS 100% 13.200 9.240 N MAPK8 n/a
7 TRCN0000194860 CAGTAAGGACTTACGTTGAAA pLKO.1 1152 CDS 100% 5.625 3.938 N MAPK8 n/a
8 TRCN0000342576 CAGTAAGGACTTACGTTGAAA pLKO_005 1152 CDS 100% 5.625 3.938 N MAPK8 n/a
9 TRCN0000010581 GACTCAGAACACAACAAACTT pLKO.1 1235 CDS 100% 5.625 3.938 N MAPK8 n/a
10 TRCN0000342626 GACTCAGAACACAACAAACTT pLKO_005 1235 CDS 100% 5.625 3.938 N MAPK8 n/a
11 TRCN0000055114 GCAGCTTATGATGCCATTCTT pLKO.1 512 CDS 100% 5.625 3.938 N Mapk8 n/a
12 TRCN0000010580 CCACAGAAATCCCTAGAAGAA pLKO.1 668 CDS 100% 4.950 3.465 N MAPK8 n/a
13 TRCN0000196304 GATTGGAGATTCTACATTCAC pLKO.1 430 CDS 100% 4.950 3.465 N MAPK8 n/a
14 TRCN0000196371 GCAAGGGATTTGTTATCCAAA pLKO.1 1268 CDS 100% 4.950 3.465 N MAPK8 n/a
15 TRCN0000196850 GTGTCTTCAATGTCAACAGAT pLKO.1 1583 CDS 100% 4.950 3.465 N MAPK8 n/a
16 TRCN0000352648 GTGTCTTCAATGTCAACAGAT pLKO_005 1583 CDS 100% 4.950 3.465 N MAPK8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323331.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01287 pDONR223 100% 97.6% 98.1% None (many diffs) n/a
2 ccsbBroad304_01287 pLX_304 52.6% 97.6% 98.1% V5 (many diffs) n/a
3 TRCN0000489338 CTCATGACGTTAAATTTCAGTTAA pLX_317 28.4% 89.1% 88.7% V5 1136_1137insAGCAC;1148_1281delinsG n/a
4 TRCN0000489471 GTGAGACGATACCTATTGCCACGT pLX_317 32.6% 89.1% 88.7% V5 (not translated due to prior stop codon) 1136_1137insAGCAC;1148_1281del n/a
5 TRCN0000492156 AACAGCCTCTTGTTACGAGGTCTG pLX_317 19.2% 89.1% 88.7% V5 (not translated due to prior stop codon) 1136_1137insAGCAC;1148_1281del n/a
6 TRCN0000487812 TGCAGATTATTTTACTCCTCGACG pLX_317 20.5% 71.4% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000488648 ACCAGGGTGAGTGAATCTAAGAAG pLX_317 20.3% 71.4% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000492117 CTAAGCTAACTACGGCGGTACGCC pLX_317 31.1% 65.3% 75.4% V5 (many diffs) n/a
9 TRCN0000491457 CCGTCCACGCTTTTACTCGGCAGT pLX_317 24.4% 65.3% 75.6% V5 (not translated due to prior stop codon) (many diffs) n/a
10 ccsbBroadEn_14803 pDONR223 61.1% 60.4% 1% None (many diffs) n/a
11 ccsbBroad304_14803 pLX_304 34.9% 60.4% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
12 TRCN0000473545 CGAAATGCGCTGAAAGCACCGTTT pLX_317 22.7% 60.4% 1% V5 (not translated due to prior stop codon) (many diffs) n/a
13 ccsbBroadEn_11057 pDONR223 100% 58.8% 67.9% None (many diffs) n/a
14 ccsbBroad304_11057 pLX_304 0% 58.8% 67.9% V5 (many diffs) n/a
15 TRCN0000468220 CCCGCTATCGAACCGGGCATATAA pLX_317 45% 58.8% 67.9% V5 (many diffs) n/a
16 ccsbBroadEn_14805 pDONR223 0% 58.8% 67.9% None (many diffs) n/a
17 ccsbBroad304_14805 pLX_304 0% 58.8% 67.9% V5 (many diffs) n/a
18 TRCN0000466133 TCATAAGCAAACAGGTTCCCACAG pLX_317 29.1% 58.8% 67.9% V5 (many diffs) n/a
Download CSV