Transcript: Human XM_011526986.1

PREDICTED: Homo sapiens pregnancy specific beta-1-glycoprotein 8 (PSG8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSG8 (440533)
Length:
1763
CDS:
112..1092

Additional Resources:

NCBI RefSeq record:
XM_011526986.1
NBCI Gene record:
PSG8 (440533)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011526986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000183477 GTGGACGAGAAACAATATATT pLKO.1 398 CDS 100% 15.000 9.000 N PSG8 n/a
2 TRCN0000150062 CCTACACCTTACACATCATAA pLKO.1 467 CDS 100% 13.200 6.600 Y PSG4 n/a
3 TRCN0000147273 GCACAGTATTCTTGGACAATT pLKO.1 916 CDS 100% 13.200 6.600 Y PSG11 n/a
4 TRCN0000271460 TTACCCTTCATTCACCTATTA pLKO_005 843 CDS 100% 13.200 6.600 Y PSG5 n/a
5 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 746 CDS 100% 4.950 2.475 Y PSG2 n/a
6 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 746 CDS 100% 4.950 2.475 Y PSG7 n/a
7 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 746 CDS 100% 4.950 2.475 Y PSG1 n/a
8 TRCN0000148821 CCAGAATCTTACTGGCTACAT pLKO.1 288 CDS 100% 4.950 2.475 Y PSG2 n/a
9 TRCN0000153704 CCAGAATCTTACTGGCTACAT pLKO.1 288 CDS 100% 4.950 2.475 Y PSG7 n/a
10 TRCN0000183054 CCCAAATTACTACAAAGCATA pLKO.1 977 CDS 100% 4.950 2.475 Y PSG2 n/a
11 TRCN0000180534 GAAACCAACAGGACCCTCTTT pLKO.1 700 CDS 100% 4.950 2.475 Y PSG8 n/a
12 TRCN0000156722 GCAGGACCCTATGAATGTGAA pLKO.1 745 CDS 100% 4.950 2.475 Y PSG3 n/a
13 TRCN0000156536 GCTGTGAGCTTAACCTGTGAT pLKO.1 601 CDS 100% 4.950 2.475 Y PSG3 n/a
14 TRCN0000183713 GTTCTTCTACTTGTCCACAAT pLKO.1 262 CDS 100% 4.950 2.475 Y PSG8 n/a
15 TRCN0000156409 CCCAGAATCTTACTGGCTACA pLKO.1 287 CDS 100% 4.050 2.025 Y PSG7 n/a
16 TRCN0000156684 GCTTGCTCTGTTCGTAACTCA pLKO.1 1009 CDS 100% 3.000 1.500 Y PSG3 n/a
17 TRCN0000271462 CTACACCTTACACATCATAAA pLKO_005 468 CDS 100% 13.200 6.600 Y PSG5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011526986.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13930 pDONR223 100% 91.3% 85.6% None (many diffs) n/a
2 ccsbBroad304_13930 pLX_304 0% 91.3% 85.6% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 91.3% 85.6% V5 (not translated due to frame shift) (many diffs) n/a
4 ccsbBroadEn_06791 pDONR223 100% 84.2% 71% None (many diffs) n/a
5 ccsbBroad304_06791 pLX_304 0% 84.2% 71% V5 (many diffs) n/a
6 TRCN0000491658 GAGACGTGCGACATTCGGCGTTTC pLX_317 40.1% 84.2% 71% V5 (many diffs) n/a
7 ccsbBroadEn_05670 pDONR223 100% 76.2% 75.3% None (many diffs) n/a
8 ccsbBroad304_05670 pLX_304 0% 76.2% 75.3% V5 (many diffs) n/a
9 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 76.2% 75.3% V5 (many diffs) n/a
10 ccsbBroadEn_01305 pDONR223 100% 73.9% 71.1% None (many diffs) n/a
11 ccsbBroad304_01305 pLX_304 0% 73.9% 71.1% V5 (many diffs) n/a
12 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 73.9% 71.1% V5 (many diffs) n/a
13 ccsbBroadEn_11063 pDONR223 100% 73.5% 70.6% None (many diffs) n/a
14 ccsbBroad304_11063 pLX_304 0% 73.5% 70.6% V5 (many diffs) n/a
15 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 73.5% 70.6% V5 (many diffs) n/a
16 ccsbBroadEn_06790 pDONR223 100% 72% 67% None (many diffs) n/a
17 ccsbBroad304_06790 pLX_304 0% 72% 67% V5 (many diffs) n/a
18 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 72% 67% V5 (many diffs) n/a
19 ccsbBroadEn_01306 pDONR223 100% 71.1% 65.8% None (many diffs) n/a
20 ccsbBroad304_01306 pLX_304 0% 71.1% 65.8% V5 (many diffs) n/a
21 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 71.1% 65.8% V5 (many diffs) n/a
22 ccsbBroadEn_06792 pDONR223 100% 71% 63.6% None (many diffs) n/a
23 ccsbBroad304_06792 pLX_304 0% 71% 63.6% V5 (many diffs) n/a
24 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 71% 63.6% V5 (many diffs) n/a
25 ccsbBroadEn_06793 pDONR223 100% 53.8% 48.8% None (many diffs) n/a
26 ccsbBroad304_06793 pLX_304 0% 53.8% 48.8% V5 (many diffs) n/a
27 TRCN0000475187 CAACATGAGCTAGTACCTTGAGAG pLX_317 68.6% 53.8% 48.8% V5 (many diffs) n/a
Download CSV