Transcript: Human XM_011532118.3

PREDICTED: Homo sapiens mitogen-activated protein kinase 10 (MAPK10), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAPK10 (5602)
Length:
6703
CDS:
380..1774

Additional Resources:

NCBI RefSeq record:
XM_011532118.3
NBCI Gene record:
MAPK10 (5602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011532118.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194704 CATACAGCACTACTTACTTAG pLKO.1 2237 3UTR 100% 10.800 15.120 N MAPK10 n/a
2 TRCN0000433905 GTCAAGTCTGATTGCACATTG pLKO_005 968 CDS 100% 10.800 15.120 N MAPK10 n/a
3 TRCN0000196303 GAATTAGACCATGAGCGAATG pLKO.1 857 CDS 100% 6.000 8.400 N MAPK10 n/a
4 TRCN0000001021 CGACGCCTTACAGCATCCCTA pLKO.1 1432 CDS 100% 0.880 1.232 N MAPK10 n/a
5 TRCN0000432277 GCCTAGTCAGATGGATGTAGA pLKO_005 2192 3UTR 100% 4.950 3.960 N MAPK10 n/a
6 TRCN0000001020 GCCATTAAGAAGCTCAGCAGA pLKO.1 650 CDS 100% 2.640 2.112 N MAPK10 n/a
7 TRCN0000001938 GCCATTAAGAAGCTCAGCAGA pLKO.1 650 CDS 100% 2.640 2.112 N MAPK10 n/a
8 TRCN0000195168 CAAGTGGATGTGTCATATATT pLKO.1 458 CDS 100% 15.000 10.500 N MAPK10 n/a
9 TRCN0000433496 GAATTATTCACAGGGATTTAA pLKO_005 930 CDS 100% 15.000 10.500 N MAPK10 n/a
10 TRCN0000417287 ATGAAGTGTGTGAACCATAAA pLKO_005 722 CDS 100% 13.200 9.240 N MAPK10 n/a
11 TRCN0000194965 CCAAATGTTGTGTGGCATTAA pLKO.1 892 CDS 100% 13.200 9.240 N MAPK10 n/a
12 TRCN0000194979 CCATTTCATGTGATCTATTAC pLKO.1 2321 3UTR 100% 13.200 9.240 N MAPK10 n/a
13 TRCN0000196370 GACAGAAATGTGGCCATTAAG pLKO.1 638 CDS 100% 13.200 9.240 N MAPK10 n/a
14 TRCN0000424750 GTATTGCAGCTAAGCTCAAAT pLKO_005 1952 3UTR 100% 13.200 9.240 N MAPK10 n/a
15 TRCN0000417185 GCCAGGGACTTGTTGTCAAAG pLKO_005 1373 CDS 100% 10.800 7.560 N MAPK10 n/a
16 TRCN0000422541 TGACCAGTGGAATAAGGTAAT pLKO_005 1186 CDS 100% 10.800 7.560 N MAPK10 n/a
17 TRCN0000001937 CCTTACAGCATCCCTACATCA pLKO.1 1437 CDS 100% 4.950 3.465 N MAPK10 n/a
18 TRCN0000001018 GTAAGAAACTATGTGGAGAAT pLKO.1 1259 CDS 100% 4.950 3.465 N MAPK10 n/a
19 TRCN0000001939 GTAAGAAACTATGTGGAGAAT pLKO.1 1259 CDS 100% 4.950 3.465 N MAPK10 n/a
20 TRCN0000001019 GCCGCGTATGATGCTGTCCTT pLKO.1 617 CDS 100% 0.880 0.616 N MAPK10 n/a
21 TRCN0000001941 CAATAAACTCAAAGCCAGCCA pLKO.1 1351 CDS 100% 0.660 0.462 N MAPK10 n/a
22 TRCN0000001017 CCAATGATGCTTACTACAGAA pLKO.1 2012 3UTR 100% 4.950 2.970 N MAPK10 n/a
23 TRCN0000001940 CCAATGATGCTTACTACAGAA pLKO.1 2012 3UTR 100% 4.950 2.970 N MAPK10 n/a
24 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4658 3UTR 100% 4.950 2.475 Y KAAG1 n/a
25 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 1843 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011532118.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487812 TGCAGATTATTTTACTCCTCGACG pLX_317 20.5% 99.6% 89.8% V5 (not translated due to prior stop codon) 1249_1250insCAGCA n/a
2 TRCN0000488648 ACCAGGGTGAGTGAATCTAAGAAG pLX_317 20.3% 99.5% 89.8% V5 (not translated due to prior stop codon) 1249_1250insCAGCA;1392_1393insG n/a
3 TRCN0000492117 CTAAGCTAACTACGGCGGTACGCC pLX_317 31.1% 90.1% 89.8% V5 960G>A;1249_1250insCAGCA;1262_1392delinsG n/a
4 TRCN0000491457 CCGTCCACGCTTTTACTCGGCAGT pLX_317 24.4% 90.1% 89.8% V5 (not translated due to prior stop codon) 960G>A;1249_1250insCAGCA;1262_1392del n/a
5 ccsbBroadEn_11057 pDONR223 100% 68.7% 68.7% None 1_435del n/a
6 ccsbBroad304_11057 pLX_304 0% 68.7% 68.7% V5 1_435del n/a
7 TRCN0000468220 CCCGCTATCGAACCGGGCATATAA pLX_317 45% 68.7% 68.7% V5 1_435del n/a
8 ccsbBroadEn_14805 pDONR223 0% 68.7% 68.7% None 1_435del n/a
9 ccsbBroad304_14805 pLX_304 0% 68.7% 68.7% V5 1_435del n/a
10 TRCN0000466133 TCATAAGCAAACAGGTTCCCACAG pLX_317 29.1% 68.7% 68.7% V5 1_435del n/a
11 ccsbBroadEn_11058 pDONR223 100% 66.7% 67% None (many diffs) n/a
12 ccsbBroad304_11058 pLX_304 0% 66.7% 67% V5 (many diffs) n/a
13 TRCN0000475774 GTGAGTTGCCAATCATGCAATTTA pLX_317 29% 66.7% 67% V5 (many diffs) n/a
14 TRCN0000489338 CTCATGACGTTAAATTTCAGTTAA pLX_317 28.4% 65.5% 75.4% V5 (many diffs) n/a
15 TRCN0000489471 GTGAGACGATACCTATTGCCACGT pLX_317 32.6% 65.5% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000492156 AACAGCCTCTTGTTACGAGGTCTG pLX_317 19.2% 65.5% 75.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV