Transcript: Human XM_017030274.1

PREDICTED: Homo sapiens killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 1 (KIR3DL1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIR3DL1 (3811)
Length:
1194
CDS:
1..1194

Additional Resources:

NCBI RefSeq record:
XM_017030274.1
NBCI Gene record:
KIR3DL1 (3811)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017030274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000149154 GAGTATTCCGAAACACCGTTT pLKO.1 221 CDS 100% 4.050 5.670 N KIR3DP1 n/a
2 TRCN0000146939 CCTATGACATCTACCATCTAT pLKO.1 746 CDS 100% 5.625 2.813 Y KIR3DP1 n/a
3 TRCN0000057031 CCTGCAATGTTGGTCAGATGT pLKO.1 423 CDS 100% 4.950 2.475 Y KIR2DS2 n/a
4 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 870 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
5 TRCN0000056825 GCAATGTTGGTCAGATGTCAT pLKO.1 426 CDS 100% 4.950 2.475 Y KIR2DL1 n/a
6 TRCN0000149432 GCAATGTTGGTCAGATGTCAT pLKO.1 426 CDS 100% 4.950 2.475 Y KIR3DP1 n/a
7 TRCN0000056932 CCCTGGTGAAATCAGAAGAGA pLKO.1 395 CDS 100% 3.000 1.500 Y KIR2DS5 n/a
8 TRCN0000061713 GTCATGTTTGAGCACTTCCTT pLKO.1 442 CDS 100% 3.000 1.500 Y KIR2DS3 n/a
9 TRCN0000056758 CCTGCAATGTTGGTCAGATAT pLKO.1 423 CDS 100% 13.200 6.600 Y KIR3DL1 n/a
10 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 928 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017030274.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09418 pDONR223 100% 75.4% 65.4% None (many diffs) n/a
2 ccsbBroad304_09418 pLX_304 0% 75.4% 65.4% V5 (many diffs) n/a
3 ccsbBroadEn_00908 pDONR223 100% 73.5% 58.8% None (many diffs) n/a
4 ccsbBroad304_00908 pLX_304 0% 73.5% 58.8% V5 (many diffs) n/a
5 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 73.5% 58.8% V5 (many diffs) n/a
6 ccsbBroadEn_13889 pDONR223 100% 73.1% 53.6% None (many diffs) n/a
7 ccsbBroadEn_00907 pDONR223 100% 71.3% 53.5% None (many diffs) n/a
8 ccsbBroad304_00907 pLX_304 0% 71.3% 53.5% V5 (many diffs) n/a
9 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 71.3% 53.5% V5 (many diffs) n/a
10 ccsbBroadEn_06489 pDONR223 100% 69.2% 51.6% None (many diffs) n/a
11 ccsbBroad304_06489 pLX_304 0% 69.2% 51.6% V5 (many diffs) n/a
12 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 69.2% 51.6% V5 (many diffs) n/a
13 ccsbBroadEn_13754 pDONR223 100% 58% 44.2% None (many diffs) n/a
14 ccsbBroad304_13754 pLX_304 0% 58% 44.2% V5 (many diffs) n/a
15 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 58% 44.2% V5 (many diffs) n/a
16 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 57.5% 49.4% V5 (not translated due to prior stop codon) (many diffs) n/a
17 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 57.3% 49.1% V5 (not translated due to prior stop codon) (many diffs) n/a
18 ccsbBroadEn_14687 pDONR223 73.4% 57.2% 48.9% None (many diffs) n/a
19 ccsbBroad304_14687 pLX_304 0% 57.2% 48.9% V5 (not translated due to prior stop codon) (many diffs) n/a
20 ccsbBroadEn_13888 pDONR223 100% 57.1% 3.9% None (many diffs) n/a
21 ccsbBroad304_13888 pLX_304 0% 57.1% 3.9% V5 (not translated due to prior stop codon) (many diffs) n/a
22 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 57.1% 3.9% V5 (not translated due to prior stop codon) (many diffs) n/a
23 ccsbBroadEn_06487 pDONR223 100% 56.7% 44.6% None (many diffs) n/a
24 ccsbBroad304_06487 pLX_304 0% 56.7% 44.6% V5 (many diffs) n/a
25 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 56.7% 44.6% V5 (many diffs) n/a
26 ccsbBroadEn_10936 pDONR223 100% 53.7% 41.7% None (many diffs) n/a
27 ccsbBroad304_10936 pLX_304 0% 53.7% 41.7% V5 (many diffs) n/a
28 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 53.7% 41.7% V5 (many diffs) n/a
Download CSV