Transcript: Mouse NM_001289899.1

Mus musculus casein kinase 1, epsilon (Csnk1e), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Csnk1e (27373)
Length:
3174
CDS:
611..1717

Additional Resources:

NCBI RefSeq record:
NM_001289899.1
NBCI Gene record:
Csnk1e (27373)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001289899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000023806 CGAGTACATACACTCCAAGAA pLKO.1 958 CDS 100% 4.950 6.930 N Csnk1e n/a
2 TRCN0000319704 CGAGTACATACACTCCAAGAA pLKO_005 958 CDS 100% 4.950 6.930 N Csnk1e n/a
3 TRCN0000023805 CGAGTTCTCAACATACCTCAA pLKO.1 1348 CDS 100% 4.050 5.670 N Csnk1e n/a
4 TRCN0000319767 CGAGTTCTCAACATACCTCAA pLKO_005 1348 CDS 100% 4.050 5.670 N Csnk1e n/a
5 TRCN0000023808 GCCCGCACACACCAGCATATT pLKO.1 1085 CDS 100% 4.400 3.080 N Csnk1e n/a
6 TRCN0000319766 GCCCGCACACACCAGCATATT pLKO_005 1085 CDS 100% 4.400 3.080 N Csnk1e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001289899.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroad304_00379 pLX_304 2% 76.3% 75.8% V5 (sequence mutation detected) (many diffs) n/a
2 ccsbBroadEn_00379 pDONR223 100% 75.4% 73.3% None (many diffs) n/a
3 TRCN0000481162 AGAGCTCGCCGCCCTTAACAATCT pLX_317 35.8% 75.4% 73.3% V5 (many diffs) n/a
4 ccsbBroadEn_14601 pDONR223 0% 75.4% 73.3% None (many diffs) n/a
5 ccsbBroad304_14601 pLX_304 49.7% 75.4% 73.3% V5 (many diffs) n/a
6 TRCN0000481381 TTTCCAAGGCATTCTACCCATATC pLX_317 32.5% 75.4% 73.3% V5 (many diffs) n/a
7 TRCN0000489403 GCAGAGAGGTCTATAAGGTCAGGT pLX_317 32.1% 75.4% 73.3% V5 (not translated due to prior stop codon) (many diffs) n/a
8 TRCN0000489692 TGCTGGAACGATACCCATGTTATC pLX_317 32% 75.4% 73.1% V5 (many diffs) n/a
9 ccsbBroadEn_06056 pDONR223 100% 70.6% 70.2% None (many diffs) n/a
10 ccsbBroad304_06056 pLX_304 0% 70.6% 70.2% V5 (many diffs) n/a
11 TRCN0000479473 AGTTACCGTGACGGCATGCCTGAA pLX_317 18.4% 70.6% 70.2% V5 (many diffs) n/a
12 ccsbBroadEn_14600 pDONR223 0% 70.6% 70.2% None (many diffs) n/a
13 ccsbBroad304_14600 pLX_304 0% 70.6% 70.2% V5 (many diffs) n/a
14 TRCN0000479372 TAGGCGTCATCTCCCTCATAAACC pLX_317 18.4% 70.6% 70.2% V5 (many diffs) n/a
15 TRCN0000488055 CATAGAACCCGCCGCCGAGCCGTC pLX_317 17.5% 70.6% 70.2% V5 (not translated due to prior stop codon) (many diffs) n/a
16 ccsbBroadEn_00378 pDONR223 100% 70.4% 71.1% None (many diffs) n/a
17 ccsbBroad304_00378 pLX_304 0% 70.4% 71.1% V5 (many diffs) n/a
18 TRCN0000467149 GTTCAACACCCCCACCGCCAACGT pLX_317 16.9% 70.4% 71.1% V5 (many diffs) n/a
19 TRCN0000487781 TATCAACCTAAGCCATCACCAAAC pLX_317 17.1% 70.4% 71.1% V5 (not translated due to prior stop codon) (many diffs) n/a
20 TRCN0000487884 GTGCGCCGACGAAGTCCCGTACGG pLX_317 16.7% 70.4% 71% V5 (many diffs) n/a
Download CSV