Transcript: Human NM_001310127.1

Homo sapiens zinc finger protein 888 (ZNF888), mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
ZNF888 (388559)
Length:
2487
CDS:
59..2215

Additional Resources:

NCBI RefSeq record:
NM_001310127.1
NBCI Gene record:
ZNF888 (388559)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001310127.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239528 ACGGGTAGTACAGACCAATAT pLKO_005 413 CDS 100% 13.200 9.240 N ZNF888 n/a
2 TRCN0000239530 TCGTGCACAGTCAACACTTAT pLKO_005 2155 CDS 100% 13.200 9.240 N ZNF888 n/a
3 TRCN0000239527 GACAAGGCTTTCAAGTGTTAC pLKO_005 2060 CDS 100% 10.800 7.560 N ZNF888 n/a
4 TRCN0000239526 AGCATACCTTGCACGTCATTA pLKO_005 904 CDS 100% 13.200 7.920 N ZNF888 n/a
5 TRCN0000239529 TCACACCTGGCACAGCATATT pLKO_005 1241 CDS 100% 13.200 7.920 N ZNF888 n/a
6 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 161 CDS 100% 15.000 7.500 Y ZNF765 n/a
7 TRCN0000147524 GAGAGTGGCAAATCCTTTAAT pLKO.1 710 CDS 100% 15.000 7.500 Y ZNF321P n/a
8 TRCN0000018107 GCTGGAAACAAGCCTATTAAA pLKO.1 446 CDS 100% 15.000 7.500 Y ZNF600 n/a
9 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 136 CDS 100% 13.200 6.600 Y ZNF765 n/a
10 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1881 CDS 100% 5.625 2.813 Y ZNF702P n/a
11 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 87 CDS 100% 5.625 2.813 Y ZNF765 n/a
12 TRCN0000150044 CCTTGAAAGACATAGGAGAAT pLKO.1 1162 CDS 100% 4.950 2.475 Y ZNF816 n/a
13 TRCN0000149463 GCACGTCATCATAGACTTCAT pLKO.1 1418 CDS 100% 4.950 2.475 Y ZNF321P n/a
14 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1041 CDS 100% 4.950 2.475 Y ZNF813 n/a
15 TRCN0000141128 CCTCAGTTTCAACATCCCAAA pLKO.1 570 CDS 100% 4.050 2.025 Y ZNF468 n/a
16 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 169 CDS 100% 2.640 1.320 Y ZNF765 n/a
17 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1209 CDS 100% 2.640 1.320 Y ZNF468 n/a
18 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1865 CDS 100% 4.950 2.475 Y ZNF28 n/a
19 TRCN0000141972 GCACAACATCAGAGAGTTCAT pLKO.1 2006 CDS 100% 4.950 2.475 Y ZNF468 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001310127.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04800 pDONR223 100% 67.3% 60.1% None (many diffs) n/a
2 ccsbBroad304_04800 pLX_304 0% 67.3% 60.1% V5 (many diffs) n/a
3 TRCN0000478315 CGTGCCTTGTCGAAGCCACGTTAA pLX_317 18.1% 67.3% 60.1% V5 (many diffs) n/a
4 ccsbBroadEn_08581 pDONR223 100% 60.4% 56% None (many diffs) n/a
5 ccsbBroad304_08581 pLX_304 0% 60.4% 56% V5 (many diffs) n/a
6 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 60.4% 56% V5 (many diffs) n/a
7 ccsbBroadEn_05629 pDONR223 100% 20.5% 17.4% None (many diffs) n/a
8 ccsbBroad304_05629 pLX_304 0% 20.5% 17.4% V5 (many diffs) n/a
9 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 20.5% 17.4% V5 (many diffs) n/a
10 ccsbBroadEn_12938 pDONR223 100% 11% 4.8% None (many diffs) n/a
11 ccsbBroad304_12938 pLX_304 0% 11% 4.8% V5 (many diffs) n/a
12 TRCN0000465769 GCGACGTTTCATCACCCAGACTTT pLX_317 100% 11% 4.8% V5 (many diffs) n/a
13 ccsbBroadEn_14339 pDONR223 100% 7.9% .4% None (many diffs) n/a
14 ccsbBroad304_14339 pLX_304 0% 7.9% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
15 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 7.9% .4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV