Transcript: Human NM_002784.5

Homo sapiens pregnancy specific beta-1-glycoprotein 9 (PSG9), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PSG9 (5678)
Length:
1707
CDS:
100..1380

Additional Resources:

NCBI RefSeq record:
NM_002784.5
NBCI Gene record:
PSG9 (5678)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244635 TAGAGAAGAAATTCGACATTT pLKO_005 492 CDS 100% 13.200 10.560 N PSG9 n/a
2 TRCN0000181053 CCTGGCTACTTCTGGTACAAA pLKO.1 286 CDS 100% 5.625 3.938 N PSG9 n/a
3 TRCN0000244634 CAACAACTGAGACACTGAGAA pLKO_005 1384 3UTR 100% 4.950 3.465 N PSG9 n/a
4 TRCN0000244633 TCAGTCATGACTGCAACAACT pLKO_005 1371 CDS 100% 4.950 3.465 N PSG9 n/a
5 TRCN0000244632 CGAGGTGATGAGACTAGAGAA pLKO_005 478 CDS 100% 4.950 2.970 N PSG9 n/a
6 TRCN0000147479 GTCATCCTAAATGTCCTCTAT pLKO.1 1069 CDS 100% 4.950 2.970 N PSG9 n/a
7 TRCN0000150062 CCTACACCTTACACATCATAA pLKO.1 455 CDS 100% 13.200 6.600 Y PSG4 n/a
8 TRCN0000179922 CGGACCTCTACCATTACATTA pLKO.1 317 CDS 100% 13.200 6.600 Y PSG6 n/a
9 TRCN0000271462 CTACACCTTACACATCATAAA pLKO_005 456 CDS 100% 13.200 6.600 Y PSG5 n/a
10 TRCN0000271507 CTACCCAGTGTCACGAGAAAT pLKO_005 988 CDS 100% 13.200 6.600 Y PSG5 n/a
11 TRCN0000271460 TTACCCTTCATTCACCTATTA pLKO_005 1110 CDS 100% 13.200 6.600 Y PSG5 n/a
12 TRCN0000179823 CACCTACATTTGGTGGCTAAA pLKO.1 906 CDS 100% 10.800 5.400 Y PSG8 n/a
13 TRCN0000158405 CCCAGTGTCACGAGAAATGAA pLKO.1 991 CDS 100% 5.625 2.813 Y PSG3 n/a
14 TRCN0000183406 CTTCAGCAATTGGTAAAGTAT pLKO.1 1564 3UTR 100% 5.625 2.813 Y PSG9 n/a
15 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 734 CDS 100% 4.950 2.475 Y PSG2 n/a
16 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 734 CDS 100% 4.950 2.475 Y PSG7 n/a
17 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 734 CDS 100% 4.950 2.475 Y PSG1 n/a
18 TRCN0000155779 CTGTGAACCTAAGAGTGAGAA pLKO.1 882 CDS 100% 4.950 2.475 Y PSG5 n/a
19 TRCN0000156722 GCAGGACCCTATGAATGTGAA pLKO.1 733 CDS 100% 4.950 2.475 Y PSG3 n/a
20 TRCN0000183713 GTTCTTCTACTTGTCCACAAT pLKO.1 250 CDS 100% 4.950 2.475 Y PSG8 n/a
21 TRCN0000146886 CAAGGAAATCTCCAAATCCAT pLKO.1 1305 CDS 100% 3.000 1.500 Y PSG6 n/a
22 TRCN0000271508 ACCTACATTTGGTGGCTAAAT pLKO_005 907 CDS 100% 13.200 6.600 Y PSG5 n/a
23 TRCN0000148542 CGAGAAATGAAACAGGACCTT pLKO.1 1001 CDS 100% 2.640 1.320 Y PSG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002784.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06792 pDONR223 100% 99.9% 99.7% None 938G>A n/a
2 ccsbBroad304_06792 pLX_304 0% 99.9% 99.7% V5 938G>A n/a
3 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 99.9% 99.7% V5 938G>A n/a
4 ccsbBroadEn_01306 pDONR223 100% 93.7% 88% None (many diffs) n/a
5 ccsbBroad304_01306 pLX_304 0% 93.7% 88% V5 (many diffs) n/a
6 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 93.7% 88% V5 (many diffs) n/a
7 ccsbBroadEn_06790 pDONR223 100% 91.8% 83.2% None (many diffs) n/a
8 ccsbBroad304_06790 pLX_304 0% 91.8% 83.2% V5 (many diffs) n/a
9 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 91.8% 83.2% V5 (many diffs) n/a
10 ccsbBroadEn_05670 pDONR223 100% 91% 83.9% None (many diffs) n/a
11 ccsbBroad304_05670 pLX_304 0% 91% 83.9% V5 (many diffs) n/a
12 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 91% 83.9% V5 (many diffs) n/a
13 ccsbBroadEn_01305 pDONR223 100% 91% 82% None (many diffs) n/a
14 ccsbBroad304_01305 pLX_304 0% 91% 82% V5 (many diffs) n/a
15 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 91% 82% V5 (many diffs) n/a
16 ccsbBroadEn_11063 pDONR223 100% 90.2% 82.5% None (many diffs) n/a
17 ccsbBroad304_11063 pLX_304 0% 90.2% 82.5% V5 (many diffs) n/a
18 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 90.2% 82.5% V5 (many diffs) n/a
19 ccsbBroadEn_06791 pDONR223 100% 70.8% 62.7% None (many diffs) n/a
20 ccsbBroad304_06791 pLX_304 0% 70.8% 62.7% V5 (many diffs) n/a
21 TRCN0000491658 GAGACGTGCGACATTCGGCGTTTC pLX_317 40.1% 70.8% 62.7% V5 (many diffs) n/a
22 ccsbBroadEn_13930 pDONR223 100% 70.3% 60.7% None (many diffs) n/a
23 ccsbBroad304_13930 pLX_304 0% 70.3% 60.7% V5 (not translated due to frame shift) (many diffs) n/a
24 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 70.3% 60.7% V5 (not translated due to frame shift) (many diffs) n/a
25 ccsbBroadEn_06793 pDONR223 100% 43% 36.3% None (many diffs) n/a
26 ccsbBroad304_06793 pLX_304 0% 43% 36.3% V5 (many diffs) n/a
27 TRCN0000475187 CAACATGAGCTAGTACCTTGAGAG pLX_317 68.6% 43% 36.3% V5 (many diffs) n/a
Download CSV