Transcript: Human NR_003099.1

Homo sapiens zinc finger protein 273 (ZNF273), transcript variant 2, non-coding RNA.

Source:
NCBI, updated 2018-12-04
Taxon:
Homo sapiens (human)
Gene:
ZNF273 (10793)
Length:
4414
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_003099.1
NBCI Gene record:
ZNF273 (10793)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_003099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108014 TGCTACTAGAGTGAATTTCTA pLKO.1 846 3UTR 100% 5.625 3.938 N ZNF273 n/a
2 TRCN0000108011 TCCTGAAGTGAATCCCTACAA pLKO.1 933 3UTR 100% 4.950 3.465 N ZNF273 n/a
3 TRCN0000108013 CCAGTCCTTAACTCTTACTAA pLKO.1 981 3UTR 100% 5.625 3.375 N ZNF273 n/a
4 TRCN0000107756 CCCTGCAATATGAAGAGACAT pLKO.1 448 3UTR 100% 4.950 2.970 N ZNF273 n/a
5 TRCN0000108010 GCTGCATCAAAGATATGAGAT pLKO.1 3055 3UTR 100% 4.950 2.970 N ZNF273 n/a
6 TRCN0000107759 AGACATGCGATGGTAGCCAAA pLKO.1 463 3UTR 100% 4.050 2.430 N ZNF273 n/a
7 TRCN0000108012 GAGAGAAACCATACAAACCTA pLKO.1 1778 3UTR 100% 3.000 1.800 N ZNF273 n/a
8 TRCN0000107757 CAATATGAAGAGACATGCGAT pLKO.1 453 3UTR 100% 2.640 1.584 N ZNF273 n/a
9 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1187 3UTR 100% 13.200 6.600 Y Zfp934 n/a
10 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1187 3UTR 100% 13.200 6.600 Y 2810408B13Rik n/a
11 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1187 3UTR 100% 13.200 6.600 Y EG668616 n/a
12 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 390 3UTR 100% 4.950 2.475 Y ZNF675 n/a
13 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 402 3UTR 100% 4.050 2.025 Y ZNF273 n/a
14 TRCN0000344452 CCCTTACTAGACATAAGATAA pLKO_005 1328 3UTR 100% 13.200 6.600 Y ZNF737 n/a
15 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1024 3UTR 100% 4.950 2.475 Y ZNF28 n/a
16 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 968 3UTR 100% 4.950 2.475 Y ZNF714 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_003099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11550 pDONR223 100% 34.2% None 1_360del;1873_4414del n/a
2 ccsbBroad304_11550 pLX_304 0% 34.2% V5 1_360del;1873_4414del n/a
3 ccsbBroadEn_15278 pDONR223 59.5% 33.5% None (many diffs) n/a
4 ccsbBroad304_15278 pLX_304 0% 33.5% V5 (many diffs) n/a
5 ccsbBroadEn_15167 pDONR223 53.6% 32.3% None (many diffs) n/a
6 ccsbBroad304_15167 pLX_304 0% 32.3% V5 (not translated due to prior stop codon) (many diffs) n/a
7 ccsbBroadEn_10024 pDONR223 100% 31.2% None (many diffs) n/a
8 ccsbBroad304_10024 pLX_304 0% 31.2% V5 (many diffs) n/a
9 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 31.2% V5 (many diffs) n/a
10 ccsbBroadEn_08635 pDONR223 100% 28.2% None (many diffs) n/a
11 ccsbBroad304_08635 pLX_304 0% 28.2% V5 (many diffs) n/a
12 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 22.6% V5 (many diffs) n/a
13 ccsbBroadEn_09302 pDONR223 100% 26.9% None (many diffs) n/a
14 ccsbBroad304_09302 pLX_304 0% 26.9% V5 (many diffs) n/a
15 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 26.9% V5 (many diffs) n/a
16 ccsbBroadEn_11384 pDONR223 100% 5.5% None (many diffs) n/a
17 ccsbBroad304_11384 pLX_304 0% 5.5% V5 (many diffs) n/a
18 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 5.5% V5 (many diffs) n/a
19 ccsbBroadEn_15729 pDONR223 0% 5.3% None (many diffs) n/a
20 ccsbBroad304_15729 pLX_304 0% 5.3% V5 (many diffs) n/a
21 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 5.3% V5 (many diffs) n/a
22 ccsbBroadEn_13746 pDONR223 100% 4.6% None (many diffs) n/a
23 ccsbBroad304_13746 pLX_304 0% 4.6% V5 (many diffs) n/a
24 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 4.6% V5 (many diffs) n/a
25 ccsbBroadEn_11549 pDONR223 100% 3.2% None (many diffs) n/a
26 ccsbBroad304_11549 pLX_304 94.6% 3.2% V5 (many diffs) n/a
27 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 3.2% V5 (many diffs) n/a
Download CSV