Transcript: Human XM_017026231.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase kinase 1 (MAP4K1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP4K1 (11184)
Length:
2837
CDS:
86..2668

Additional Resources:

NCBI RefSeq record:
XM_017026231.1
NBCI Gene record:
MAP4K1 (11184)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017026231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428126 AGTCGTCTGACGATGACTATG pLKO_005 1170 CDS 100% 10.800 15.120 N MAP4K1 n/a
2 TRCN0000195724 CAGAAGGAAATCCTCATATTG pLKO.1 224 CDS 100% 13.200 9.240 N MAP4K1 n/a
3 TRCN0000428425 CCACGCTGGAAATGCTCTTTC pLKO_005 1761 CDS 100% 10.800 7.560 N MAP4K1 n/a
4 TRCN0000427835 CCAGACGCCTCTCTTTCATTG pLKO_005 546 CDS 100% 10.800 7.560 N MAP4K1 n/a
5 TRCN0000435578 GAGCTAACATCCTCATCAATG pLKO_005 465 CDS 100% 10.800 7.560 N MAP4K1 n/a
6 TRCN0000425617 CAGAGCTCCAGATTAGCTATG pLKO_005 375 CDS 100% 6.000 4.200 N MAP4K1 n/a
7 TRCN0000199899 GATGTGCCCTTCTCGTAAAGT pLKO.1 1614 CDS 100% 5.625 3.938 N MAP4K1 n/a
8 TRCN0000001633 GCCTTCCACAACTTCATCAAA pLKO.1 782 CDS 100% 5.625 3.938 N MAP4K1 n/a
9 TRCN0000199759 GCCTACCATGGGAGTTATCTC pLKO.1 272 CDS 100% 4.950 3.465 N MAP4K1 n/a
10 TRCN0000199714 GTGGGTGTACTCCATCAACAA pLKO.1 1795 CDS 100% 4.950 3.465 N MAP4K1 n/a
11 TRCN0000001636 TGGCAAGGAAGAACATGGTTT pLKO.1 1938 CDS 100% 4.950 3.465 N MAP4K1 n/a
12 TRCN0000001635 GAAGAAGATACACAGGGACAT pLKO.1 439 CDS 100% 4.050 2.835 N MAP4K1 n/a
13 TRCN0000199758 GCCCAGTGGATGATCCTACTG pLKO.1 2681 3UTR 100% 1.350 0.945 N MAP4K1 n/a
14 TRCN0000001634 GTGAAGATGGAGCCTGATGAT pLKO.1 188 CDS 100% 4.950 2.970 N MAP4K1 n/a
15 TRCN0000199655 GATGATCCTACTGCTCCCAGC pLKO.1 2689 3UTR 100% 0.400 0.240 N MAP4K1 n/a
16 TRCN0000001632 ACATGACTTTAGCCTCTGCAA pLKO.1 2819 3UTR 100% 2.640 1.848 N MAP4K1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017026231.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14988 pDONR223 63.5% 89.7% 25.5% None (many diffs) n/a
2 ccsbBroad304_14988 pLX_304 0% 89.7% 25.5% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000467287 ACCAAATTTTTTACCGGGCTGTTT pLX_317 13.8% 89.7% 25.5% V5 (not translated due to prior stop codon) (many diffs) n/a
4 ccsbBroadEn_11616 pDONR223 100% 4.2% 2.6% None (many diffs) n/a
5 ccsbBroad304_11616 pLX_304 0% 4.2% 2.6% V5 (many diffs) n/a
6 TRCN0000467678 CCTCCCCTCACACCTCGTCAAAAC pLX_317 100% 4.2% 2.6% V5 (many diffs) n/a
7 ccsbBroadEn_10792 pDONR223 100% 4.2% 3.6% None (many diffs) n/a
8 ccsbBroad304_10792 pLX_304 0% 4.2% 3.6% V5 (many diffs) n/a
9 TRCN0000472287 GCCTGGAGAGCTTTCCTCGTCACG pLX_317 100% 4.2% 3.6% V5 (many diffs) n/a
10 ccsbBroadEn_13781 pDONR223 100% 4% 2.2% None (many diffs) n/a
11 ccsbBroad304_13781 pLX_304 0% 4% 2.2% V5 (many diffs) n/a
12 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 4% 2.2% V5 (many diffs) n/a
13 ccsbBroadEn_15487 pDONR223 0% 3.1% 1.8% None (many diffs) n/a
14 ccsbBroad304_15487 pLX_304 0% 3.1% 1.8% V5 (many diffs) n/a
15 TRCN0000473708 TAGCATCGTTGCACGCGCACGTTG pLX_317 100% 3.1% 1.8% V5 (many diffs) n/a
Download CSV