Transcript: Human XM_017027003.1

PREDICTED: Homo sapiens pregnancy specific beta-1-glycoprotein 5 (PSG5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSG5 (5673)
Length:
1634
CDS:
130..1137

Additional Resources:

NCBI RefSeq record:
XM_017027003.1
NBCI Gene record:
PSG5 (5673)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271463 TCCATGTTATTGGACTAAATA pLKO_005 1386 3UTR 100% 15.000 9.000 N PSG5 n/a
2 TRCN0000155520 GATGGACCTCTACCATTACAT pLKO.1 345 CDS 100% 5.625 3.375 N PSG5 n/a
3 TRCN0000154402 GCCGTGAAGTCATTTCTGTAT pLKO.1 1140 3UTR 100% 4.950 2.970 N PSG5 n/a
4 TRCN0000156697 CCTTCAGGAATAGGACGTCTT pLKO.1 1096 CDS 100% 4.050 2.430 N PSG5 n/a
5 TRCN0000271508 ACCTACATTTGGTGGCTAAAT pLKO_005 658 CDS 100% 13.200 6.600 Y PSG5 n/a
6 TRCN0000150062 CCTACACCTTACACATCATAA pLKO.1 485 CDS 100% 13.200 6.600 Y PSG4 n/a
7 TRCN0000271462 CTACACCTTACACATCATAAA pLKO_005 486 CDS 100% 13.200 6.600 Y PSG5 n/a
8 TRCN0000271507 CTACCCAGTGTCACGAGAAAT pLKO_005 739 CDS 100% 13.200 6.600 Y PSG5 n/a
9 TRCN0000271460 TTACCCTTCATTCACCTATTA pLKO_005 861 CDS 100% 13.200 6.600 Y PSG5 n/a
10 TRCN0000179823 CACCTACATTTGGTGGCTAAA pLKO.1 657 CDS 100% 10.800 5.400 Y PSG8 n/a
11 TRCN0000151934 CTTCCTCTCCTTAATCCAATA pLKO.1 1114 CDS 100% 10.800 5.400 Y PSG5 n/a
12 TRCN0000158405 CCCAGTGTCACGAGAAATGAA pLKO.1 742 CDS 100% 5.625 2.813 Y PSG3 n/a
13 TRCN0000183422 CCTGATAACTTCAAGATCATA pLKO.1 1287 3UTR 100% 5.625 2.813 Y PSG2 n/a
14 TRCN0000156721 GCTGGCTACATCTGGTACAAA pLKO.1 316 CDS 100% 5.625 2.813 Y PSG3 n/a
15 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 764 CDS 100% 4.950 2.475 Y PSG2 n/a
16 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 764 CDS 100% 4.950 2.475 Y PSG7 n/a
17 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 764 CDS 100% 4.950 2.475 Y PSG1 n/a
18 TRCN0000183054 CCCAAATTACTACAAAGCATA pLKO.1 995 CDS 100% 4.950 2.475 Y PSG2 n/a
19 TRCN0000155779 CTGTGAACCTAAGAGTGAGAA pLKO.1 633 CDS 100% 4.950 2.475 Y PSG5 n/a
20 TRCN0000188876 GCCCTACATCACCATCAACAA pLKO.1 573 CDS 100% 4.950 2.475 Y PSG1 n/a
21 TRCN0000156672 GTCACCCTGAATGTCCTCTAT pLKO.1 820 CDS 100% 4.950 2.475 Y PSG5 n/a
22 TRCN0000183713 GTTCTTCTACTTGTCCACAAT pLKO.1 280 CDS 100% 4.950 2.475 Y PSG8 n/a
23 TRCN0000151218 GTTGCTTTGATTCTTCCTCAA pLKO.1 1177 3UTR 100% 4.050 2.025 Y PSG5 n/a
24 TRCN0000156100 CAAAGCATAGAGGGCTCTATA pLKO.1 1007 CDS 100% 1.320 0.660 Y PSG5 n/a
25 TRCN0000148542 CGAGAAATGAAACAGGACCTT pLKO.1 752 CDS 100% 2.640 1.320 Y PSG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027003.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06791 pDONR223 100% 99.2% 98.8% None (many diffs) n/a
2 ccsbBroad304_06791 pLX_304 0% 99.2% 98.8% V5 (many diffs) n/a
3 TRCN0000491658 GAGACGTGCGACATTCGGCGTTTC pLX_317 40.1% 99.2% 98.8% V5 (many diffs) n/a
4 ccsbBroadEn_13930 pDONR223 100% 87.3% 74.7% None (many diffs) n/a
5 ccsbBroad304_13930 pLX_304 0% 87.3% 74.7% V5 (not translated due to frame shift) (many diffs) n/a
6 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 87.3% 74.7% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_06790 pDONR223 100% 74.4% 70% None (many diffs) n/a
8 ccsbBroad304_06790 pLX_304 0% 74.4% 70% V5 (many diffs) n/a
9 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 74.4% 70% V5 (many diffs) n/a
10 ccsbBroadEn_05670 pDONR223 100% 72% 66.7% None (many diffs) n/a
11 ccsbBroad304_05670 pLX_304 0% 72% 66.7% V5 (many diffs) n/a
12 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 72% 66.7% V5 (many diffs) n/a
13 ccsbBroadEn_01306 pDONR223 100% 71.5% 65.9% None (many diffs) n/a
14 ccsbBroad304_01306 pLX_304 0% 71.5% 65.9% V5 (many diffs) n/a
15 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 71.5% 65.9% V5 (many diffs) n/a
16 ccsbBroadEn_01305 pDONR223 100% 71.4% 65.6% None (many diffs) n/a
17 ccsbBroad304_01305 pLX_304 0% 71.4% 65.6% V5 (many diffs) n/a
18 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 71.4% 65.6% V5 (many diffs) n/a
19 ccsbBroadEn_11063 pDONR223 100% 71.4% 66.5% None (many diffs) n/a
20 ccsbBroad304_11063 pLX_304 0% 71.4% 66.5% V5 (many diffs) n/a
21 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 71.4% 66.5% V5 (many diffs) n/a
22 ccsbBroadEn_06792 pDONR223 100% 71% 63.1% None (many diffs) n/a
23 ccsbBroad304_06792 pLX_304 0% 71% 63.1% V5 (many diffs) n/a
24 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 71% 63.1% V5 (many diffs) n/a
Download CSV