Transcript: Human XM_017027202.2

PREDICTED: Homo sapiens zinc finger protein 708 (ZNF708), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF708 (7562)
Length:
4685
CDS:
333..1796

Additional Resources:

NCBI RefSeq record:
XM_017027202.2
NBCI Gene record:
ZNF708 (7562)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239659 AGGAGGTCACAAGGGACTTAA pLKO_005 470 CDS 100% 13.200 9.240 N ZNF708 n/a
2 TRCN0000158564 CCCAAACTAACGGTAGATAAA pLKO.1 3092 3UTR 100% 13.200 9.240 N ZNF708 n/a
3 TRCN0000239658 GACCTTAGGCCAGAGCAATAT pLKO_005 354 CDS 100% 13.200 9.240 N ZNF708 n/a
4 TRCN0000159275 GCTTCAGACATTACACTATAT pLKO.1 3046 3UTR 100% 13.200 9.240 N ZNF708 n/a
5 TRCN0000239657 GGATATCAGAAAGGCTGTAAA pLKO_005 423 CDS 100% 13.200 9.240 N ZNF708 n/a
6 TRCN0000239660 TCTAAGTGGAGATGGTATTTG pLKO_005 3727 3UTR 100% 13.200 9.240 N ZNF708 n/a
7 TRCN0000239656 TATTCTGTCCTCTCATCTTAC pLKO_005 1559 CDS 100% 10.800 7.560 N ZNF708 n/a
8 TRCN0000159621 GCATCAAAGATAGGAGAGTTT pLKO.1 3626 3UTR 100% 4.950 3.465 N ZNF708 n/a
9 TRCN0000160536 CTCAACCCTTATGAAACATAA pLKO.1 1652 CDS 100% 13.200 6.600 Y ZNF708 n/a
10 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1180 CDS 100% 13.200 6.600 Y ZNF138 n/a
11 TRCN0000243748 CTGGAAAGAAACCCTACAAAT pLKO_005 1348 CDS 100% 13.200 6.600 Y Gm6871 n/a
12 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 760 CDS 100% 13.200 6.600 Y Zfp934 n/a
13 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 760 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
14 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 760 CDS 100% 13.200 6.600 Y EG668616 n/a
15 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2159 3UTR 100% 5.625 2.813 Y ZNF254 n/a
16 TRCN0000218427 ACTGGAGAGAAACCCTATAAA pLKO_005 1515 CDS 100% 15.000 7.500 Y ZNF443 n/a
17 TRCN0000374174 ACTGGAGAGAAACCCTATAAA pLKO_005 1515 CDS 100% 15.000 7.500 Y Zfp97 n/a
18 TRCN0000162795 CTTCCAAAGTGCTGGGATTAT pLKO.1 4433 3UTR 100% 13.200 6.600 Y SLC48A1 n/a
19 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 164 5UTR 100% 4.950 2.475 Y ZNF430 n/a
20 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 3279 3UTR 100% 4.950 2.475 Y C16orf89 n/a
21 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1717 CDS 100% 4.950 2.475 Y ZNF714 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027202.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09774 pDONR223 100% 80.2% 69.3% None (many diffs) n/a
2 ccsbBroad304_09774 pLX_304 0% 80.2% 69.3% V5 (many diffs) n/a
3 TRCN0000472815 CCTGACTCCCTTTAAGTGTTCGTG pLX_317 27.4% 80.2% 69.3% V5 (many diffs) n/a
4 ccsbBroadEn_11232 pDONR223 100% 77.5% 68.6% None (many diffs) n/a
5 ccsbBroad304_11232 pLX_304 0% 77.5% 68.6% V5 (many diffs) n/a
6 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 77.5% 68.6% V5 (many diffs) n/a
7 ccsbBroadEn_15278 pDONR223 59.5% 70.6% 60.7% None (many diffs) n/a
8 ccsbBroad304_15278 pLX_304 0% 70.6% 60.7% V5 (many diffs) n/a
9 ccsbBroadEn_09784 pDONR223 100% 66.6% 56.4% None (many diffs) n/a
10 ccsbBroad304_09784 pLX_304 0% 66.6% 56.4% V5 (many diffs) n/a
11 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 66.6% 56.4% V5 (many diffs) n/a
12 ccsbBroadEn_15167 pDONR223 53.6% 65% 20.8% None (many diffs) n/a
13 ccsbBroad304_15167 pLX_304 0% 65% 20.8% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_08635 pDONR223 100% 62.2% 52.1% None (many diffs) n/a
15 ccsbBroad304_08635 pLX_304 0% 62.2% 52.1% V5 (many diffs) n/a
16 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 45.8% 36.9% V5 (many diffs) n/a
17 ccsbBroadEn_15273 pDONR223 50.9% 61.1% 51.1% None (many diffs) n/a
18 ccsbBroad304_15273 pLX_304 0% 61.1% 51.1% V5 (many diffs) n/a
19 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 20.3% 15.8% V5 (not translated due to frame shift) (many diffs) n/a
20 ccsbBroadEn_07157 pDONR223 100% 52.1% 45.6% None (many diffs) n/a
21 ccsbBroad304_07157 pLX_304 0% 52.1% 45.6% V5 (many diffs) n/a
22 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 52.1% 45.6% V5 (many diffs) n/a
Download CSV