Transcript: Human NM_001368254.1

Homo sapiens killer cell immunoglobulin-like receptor 3DS1-like (LOC112268355), mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
LOC112268355 (112268355)
Length:
1892
CDS:
47..1195

Additional Resources:

NCBI RefSeq record:
NM_001368254.1
NBCI Gene record:
LOC112268355 (112268355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001368254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243133 GGAGGTGTCATACGCATAATT pLKO_005 1227 3UTR 100% 15.000 7.500 Y KIR3DS1 n/a
2 TRCN0000243134 CATCGTGGTCACAGGTCTATA pLKO_005 688 CDS 100% 13.200 6.600 Y KIR3DS1 n/a
3 TRCN0000056758 CCTGCAATGTTGGTCAGATAT pLKO.1 469 CDS 100% 13.200 6.600 Y KIR3DL1 n/a
4 TRCN0000435229 GAGGTGTCATACGCATAATTG pLKO_005 1228 3UTR 100% 13.200 6.600 Y KIR2DS4 n/a
5 TRCN0000180997 GCTCTTCCTCACACCACAAAT pLKO.1 1505 3UTR 100% 13.200 6.600 Y KIR2DL5B n/a
6 TRCN0000418745 AGGCATCAGTCTTCATCTTAG pLKO_005 1478 3UTR 100% 10.800 5.400 Y KIR2DS5 n/a
7 TRCN0000056760 CCACAGAACCAAGCTCCAAAT pLKO.1 1023 CDS 100% 10.800 5.400 Y KIR3DL1 n/a
8 TRCN0000243132 CTATGACATGTACCATCTATC pLKO_005 793 CDS 100% 10.800 5.400 Y KIR3DS1 n/a
9 TRCN0000243131 TCGGTGTCACTATCGTCATAG pLKO_005 187 CDS 100% 10.800 5.400 Y KIR3DS1 n/a
10 TRCN0000057030 CCTATGACATGTACCATCTAT pLKO.1 792 CDS 100% 5.625 2.813 Y KIR2DS2 n/a
11 TRCN0000056762 GCGCAAGGTCAACAGAACATT pLKO.1 853 CDS 100% 5.625 2.813 Y KIR3DL1 n/a
12 TRCN0000243130 CAGAAGTGAACAGCGAGGATT pLKO_005 1187 CDS 100% 4.950 2.475 Y KIR3DS1 n/a
13 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 916 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
14 TRCN0000056930 CTCCTCTTCTTTCTCCTTCAT pLKO.1 1109 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
15 TRCN0000056761 GCTATACAAAGAAGACAGAAT pLKO.1 223 CDS 100% 4.950 2.475 Y KIR3DL1 n/a
16 TRCN0000056929 GCTTGTTTCTGTCACAGGAAA pLKO.1 979 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
17 TRCN0000061717 TCAGGAGGTGTCATACGCATA pLKO.1 1224 3UTR 100% 4.050 2.025 Y KIR2DS3 n/a
18 TRCN0000056931 CAGGTCTATATGAGAAACCTT pLKO.1 699 CDS 100% 3.000 1.500 Y KIR2DS5 n/a
19 TRCN0000056990 GATTCTGATGAACAAGACCAT pLKO.1 1204 3UTR 100% 2.640 1.320 Y KIR2DS1 n/a
20 TRCN0000057032 GTCACAGGAAACCCTTCAAAT pLKO.1 989 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
21 TRCN0000063023 CCTCCTCTTCTTTCTCCTTTA pLKO.1 1108 CDS 100% 10.800 5.400 Y KIR3DL2 n/a
22 TRCN0000417192 TTGGGACCTCAGTGGTCAAAC pLKO_005 1074 CDS 100% 10.800 5.400 Y KIR2DS5 n/a
23 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 974 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
24 TRCN0000057031 CCTGCAATGTTGGTCAGATGT pLKO.1 469 CDS 100% 4.950 2.475 Y KIR2DS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001368254.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00908 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00908 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 100% 100% V5 n/a
4 ccsbBroadEn_13889 pDONR223 100% 99.6% 74% None (many diffs) n/a
5 ccsbBroadEn_06489 pDONR223 100% 84.8% 79.7% None (many diffs) n/a
6 ccsbBroad304_06489 pLX_304 0% 84.8% 79.7% V5 (many diffs) n/a
7 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 84.8% 79.7% V5 (many diffs) n/a
8 ccsbBroadEn_00907 pDONR223 100% 77.4% 68.7% None (many diffs) n/a
9 ccsbBroad304_00907 pLX_304 0% 77.4% 68.7% V5 (many diffs) n/a
10 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 77.4% 68.7% V5 (many diffs) n/a
11 ccsbBroadEn_09418 pDONR223 100% 73% 59.8% None (many diffs) n/a
12 ccsbBroad304_09418 pLX_304 0% 73% 59.8% V5 (many diffs) n/a
13 ccsbBroadEn_13888 pDONR223 100% 65.3% 3.2% None (many diffs) n/a
14 ccsbBroad304_13888 pLX_304 0% 65.3% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
15 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 65.3% 3.2% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 65.1% 57% V5 (not translated due to prior stop codon) (many diffs) n/a
17 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 65.1% 57% V5 (not translated due to prior stop codon) (many diffs) n/a
18 ccsbBroadEn_14687 pDONR223 73.4% 65.1% 56.8% None (many diffs) n/a
19 ccsbBroad304_14687 pLX_304 0% 65.1% 56.8% V5 (not translated due to prior stop codon) (many diffs) n/a
20 ccsbBroadEn_13754 pDONR223 100% 61.1% 52.8% None (many diffs) n/a
21 ccsbBroad304_13754 pLX_304 0% 61.1% 52.8% V5 (many diffs) n/a
22 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 61.1% 52.8% V5 (many diffs) n/a
23 ccsbBroadEn_06487 pDONR223 100% 59.8% 50.2% None (many diffs) n/a
24 ccsbBroad304_06487 pLX_304 0% 59.8% 50.2% V5 (many diffs) n/a
25 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 59.8% 50.2% V5 (many diffs) n/a
26 ccsbBroadEn_10936 pDONR223 100% 55.2% 47% None (many diffs) n/a
27 ccsbBroad304_10936 pLX_304 0% 55.2% 47% V5 (many diffs) n/a
28 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 55.2% 47% V5 (many diffs) n/a
29 ccsbBroadEn_06488 pDONR223 100% 50.6% 40.9% None (many diffs) n/a
30 ccsbBroad304_06488 pLX_304 0% 50.6% 40.9% V5 (many diffs) n/a
31 TRCN0000480702 ACTCACGGACTGCAGTACACGCGC pLX_317 26.5% 50.6% 40.9% V5 (many diffs) n/a
Download CSV