Transcript: Human NM_006905.3

Homo sapiens pregnancy specific beta-1-glycoprotein 1 (PSG1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PSG1 (5669)
Length:
2272
CDS:
133..1413

Additional Resources:

NCBI RefSeq record:
NM_006905.3
NBCI Gene record:
PSG1 (5669)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373263 TAATCTATCTACAGCTTATAG pLKO_005 1717 3UTR 100% 13.200 9.240 N PSG1 n/a
2 TRCN0000203686 CCAAGCAGGAAGAACATTGAT pLKO.1 1586 3UTR 100% 5.625 3.938 N PSG1 n/a
3 TRCN0000185876 GCCATATTACTACAAAGCATA pLKO.1 1277 CDS 100% 4.950 3.465 N PSG1 n/a
4 TRCN0000373262 AGTCGAAGTCTCTGGTAAGTG pLKO_005 1362 CDS 100% 4.950 2.970 N PSG1 n/a
5 TRCN0000163326 CCAGAATCTTACCGGCTACAT pLKO.1 309 CDS 100% 4.950 2.970 N PSG1 n/a
6 TRCN0000271508 ACCTACATTTGGTGGCTAAAT pLKO_005 940 CDS 100% 13.200 6.600 Y PSG5 n/a
7 TRCN0000378965 ATACTTCTGGGAACCGTAATT pLKO_005 1752 3UTR 100% 13.200 6.600 Y PSG1 n/a
8 TRCN0000150062 CCTACACCTTACACATCATAA pLKO.1 488 CDS 100% 13.200 6.600 Y PSG4 n/a
9 TRCN0000271462 CTACACCTTACACATCATAAA pLKO_005 489 CDS 100% 13.200 6.600 Y PSG5 n/a
10 TRCN0000271507 CTACCCAGTGTCACGAGAAAT pLKO_005 1021 CDS 100% 13.200 6.600 Y PSG5 n/a
11 TRCN0000147273 GCACAGTATTCTTGGACAATT pLKO.1 1216 CDS 100% 13.200 6.600 Y PSG11 n/a
12 TRCN0000271460 TTACCCTTCATTCACCTATTA pLKO_005 1143 CDS 100% 13.200 6.600 Y PSG5 n/a
13 TRCN0000179823 CACCTACATTTGGTGGCTAAA pLKO.1 939 CDS 100% 10.800 5.400 Y PSG8 n/a
14 TRCN0000158405 CCCAGTGTCACGAGAAATGAA pLKO.1 1024 CDS 100% 5.625 2.813 Y PSG3 n/a
15 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 767 CDS 100% 4.950 2.475 Y PSG2 n/a
16 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 767 CDS 100% 4.950 2.475 Y PSG7 n/a
17 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 767 CDS 100% 4.950 2.475 Y PSG1 n/a
18 TRCN0000155779 CTGTGAACCTAAGAGTGAGAA pLKO.1 915 CDS 100% 4.950 2.475 Y PSG5 n/a
19 TRCN0000180534 GAAACCAACAGGACCCTCTTT pLKO.1 721 CDS 100% 4.950 2.475 Y PSG8 n/a
20 TRCN0000156722 GCAGGACCCTATGAATGTGAA pLKO.1 766 CDS 100% 4.950 2.475 Y PSG3 n/a
21 TRCN0000188876 GCCCTACATCACCATCAACAA pLKO.1 855 CDS 100% 4.950 2.475 Y PSG1 n/a
22 TRCN0000156672 GTCACCCTGAATGTCCTCTAT pLKO.1 1102 CDS 100% 4.950 2.475 Y PSG5 n/a
23 TRCN0000183713 GTTCTTCTACTTGTCCACAAT pLKO.1 283 CDS 100% 4.950 2.475 Y PSG8 n/a
24 TRCN0000156536 GCTGTGAGCTTAACCTGTGAT pLKO.1 622 CDS 100% 4.950 2.475 Y PSG3 n/a
25 TRCN0000157364 CGAGCCAACCAAAGTTTCCAA pLKO.1 252 CDS 100% 3.000 1.500 Y PSG3 n/a
26 TRCN0000148542 CGAGAAATGAAACAGGACCTT pLKO.1 1034 CDS 100% 2.640 1.320 Y PSG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006905.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01305 pDONR223 100% 97.6% 97.4% None (many diffs) n/a
2 ccsbBroad304_01305 pLX_304 0% 97.6% 97.4% V5 (many diffs) n/a
3 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 97.6% 97.4% V5 (many diffs) n/a
4 ccsbBroadEn_05670 pDONR223 100% 95.7% 92.4% None (many diffs) n/a
5 ccsbBroad304_05670 pLX_304 0% 95.7% 92.4% V5 (many diffs) n/a
6 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 95.7% 92.4% V5 (many diffs) n/a
7 ccsbBroadEn_11063 pDONR223 100% 95.4% 93.4% None (many diffs) n/a
8 ccsbBroad304_11063 pLX_304 0% 95.4% 93.4% V5 (many diffs) n/a
9 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 95.4% 93.4% V5 (many diffs) n/a
10 ccsbBroadEn_06790 pDONR223 100% 92.9% 88.2% None (many diffs) n/a
11 ccsbBroad304_06790 pLX_304 0% 92.9% 88.2% V5 (many diffs) n/a
12 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 92.9% 88.2% V5 (many diffs) n/a
13 ccsbBroadEn_01306 pDONR223 100% 91.6% 85.3% None (many diffs) n/a
14 ccsbBroad304_01306 pLX_304 0% 91.6% 85.3% V5 (many diffs) n/a
15 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 91.6% 85.3% V5 (many diffs) n/a
16 ccsbBroadEn_06792 pDONR223 100% 90.7% 82% None (many diffs) n/a
17 ccsbBroad304_06792 pLX_304 0% 90.7% 82% V5 (many diffs) n/a
18 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 90.7% 82% V5 (many diffs) n/a
19 ccsbBroadEn_06791 pDONR223 100% 70.9% 65.1% None (many diffs) n/a
20 ccsbBroad304_06791 pLX_304 0% 70.9% 65.1% V5 (many diffs) n/a
21 TRCN0000491658 GAGACGTGCGACATTCGGCGTTTC pLX_317 40.1% 70.9% 65.1% V5 (many diffs) n/a
22 ccsbBroadEn_13930 pDONR223 100% 70.7% 65.8% None (many diffs) n/a
23 ccsbBroad304_13930 pLX_304 0% 70.7% 65.8% V5 (not translated due to frame shift) (many diffs) n/a
24 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 70.7% 65.8% V5 (not translated due to frame shift) (many diffs) n/a
25 ccsbBroadEn_06793 pDONR223 100% 42.5% 37.6% None (many diffs) n/a
26 ccsbBroad304_06793 pLX_304 0% 42.5% 37.6% V5 (many diffs) n/a
27 TRCN0000475187 CAACATGAGCTAGTACCTTGAGAG pLX_317 68.6% 42.5% 37.6% V5 (many diffs) n/a
Download CSV