Transcript: Human NM_015868.3

Homo sapiens killer cell immunoglobulin like receptor, two Ig domains and long cytoplasmic tail 3 (KIR2DL3), mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
KIR2DL3 (3804)
Length:
1592
CDS:
34..1059

Additional Resources:

NCBI RefSeq record:
NM_015868.3
NBCI Gene record:
KIR2DL3 (3804)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_015868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063689 GTCAGGTTTCAGCACTTCCTT pLKO.1 190 CDS 100% 3.000 1.800 N KIR2DL3 n/a
2 TRCN0000057029 CATCGTCATCACAGGTCTATA pLKO.1 390 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
3 TRCN0000437846 GACCCTCAGGAGGTGACATAT pLKO_005 922 CDS 100% 13.200 6.600 Y KIR2DL5A n/a
4 TRCN0000061459 GCACAGAGAAGGGAAGTTTAA pLKO.1 213 CDS 100% 13.200 6.600 Y KIR2DL2 n/a
5 TRCN0000180997 GCTCTTCCTCACACCACAAAT pLKO.1 1208 3UTR 100% 13.200 6.600 Y KIR2DL5B n/a
6 TRCN0000057032 GTCACAGGAAACCCTTCAAAT pLKO.1 691 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
7 TRCN0000421852 TCCTTTGCTTAGCCCACAATT pLKO_005 1296 3UTR 100% 13.200 6.600 Y KIR2DS5 n/a
8 TRCN0000437763 AGGCGTGAGTCTGCATCTTAG pLKO_005 1181 3UTR 100% 10.800 5.400 Y KIR2DL1 n/a
9 TRCN0000243132 CTATGACATGTACCATCTATC pLKO_005 495 CDS 100% 10.800 5.400 Y KIR3DS1 n/a
10 TRCN0000057030 CCTATGACATGTACCATCTAT pLKO.1 494 CDS 100% 5.625 2.813 Y KIR2DS2 n/a
11 TRCN0000063692 AGGGAAGTTTAAGGACACTTT pLKO.1 222 CDS 100% 4.950 2.475 Y KIR2DL3 n/a
12 TRCN0000057031 CCTGCAATGTTGGTCAGATGT pLKO.1 171 CDS 100% 4.950 2.475 Y KIR2DS2 n/a
13 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 618 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
14 TRCN0000056930 CTCCTCTTCTTTCTCCTTCAT pLKO.1 811 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
15 TRCN0000056929 GCTTGTTTCTGTCACAGGAAA pLKO.1 681 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
16 TRCN0000063691 TGCAGGGAACAGAACAGTGAA pLKO.1 879 CDS 100% 4.950 2.475 Y KIR2DL3 n/a
17 TRCN0000061460 CACAGTTGAATCACTGCGTTT pLKO.1 944 CDS 100% 4.050 2.025 Y KIR2DL2 n/a
18 TRCN0000056824 CCCAACAGATATCATCGTGTA pLKO.1 1011 CDS 100% 4.050 2.025 Y KIR2DL1 n/a
19 TRCN0000056931 CAGGTCTATATGAGAAACCTT pLKO.1 401 CDS 100% 3.000 1.500 Y KIR2DS5 n/a
20 TRCN0000056932 CCCTGGTGAAATCAGAAGAGA pLKO.1 143 CDS 100% 3.000 1.500 Y KIR2DS5 n/a
21 TRCN0000063688 GCACAGTTGAATCACTGCGTT pLKO.1 943 CDS 100% 2.640 1.320 Y KIR2DL3 n/a
22 TRCN0000056758 CCTGCAATGTTGGTCAGATAT pLKO.1 171 CDS 100% 13.200 6.600 Y KIR3DL1 n/a
23 TRCN0000063023 CCTCCTCTTCTTTCTCCTTTA pLKO.1 810 CDS 100% 10.800 5.400 Y KIR3DL2 n/a
24 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 676 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
25 TRCN0000061714 GAACAGTGAACAGGGAGGATT pLKO.1 890 CDS 100% 4.950 2.475 Y KIR2DS3 n/a
26 TRCN0000056825 GCAATGTTGGTCAGATGTCAT pLKO.1 174 CDS 100% 4.950 2.475 Y KIR2DL1 n/a
27 TRCN0000149432 GCAATGTTGGTCAGATGTCAT pLKO.1 174 CDS 100% 4.950 2.475 Y KIR3DP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_015868.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06487 pDONR223 100% 99.6% 99.1% None (many diffs) n/a
2 ccsbBroad304_06487 pLX_304 0% 99.6% 99.1% V5 (many diffs) n/a
3 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 99.6% 99.1% V5 (many diffs) n/a
4 ccsbBroadEn_10936 pDONR223 100% 86.6% 82.9% None (many diffs) n/a
5 ccsbBroad304_10936 pLX_304 0% 86.6% 82.9% V5 (many diffs) n/a
6 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 86.6% 82.9% V5 (many diffs) n/a
7 ccsbBroadEn_13754 pDONR223 100% 86.2% 83.6% None (many diffs) n/a
8 ccsbBroad304_13754 pLX_304 0% 86.2% 83.6% V5 (many diffs) n/a
9 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 86.2% 83.6% V5 (many diffs) n/a
10 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 84.3% 70% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 83.9% 69.2% V5 (not translated due to prior stop codon) (many diffs) n/a
12 ccsbBroadEn_14687 pDONR223 73.4% 83.7% 69.2% None (many diffs) n/a
13 ccsbBroad304_14687 pLX_304 0% 83.7% 69.2% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_13888 pDONR223 100% 83.8% 3% None (many diffs) n/a
15 ccsbBroad304_13888 pLX_304 0% 83.8% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 83.8% 3% V5 (not translated due to prior stop codon) (many diffs) n/a
17 ccsbBroadEn_06489 pDONR223 100% 71.1% 65% None (many diffs) n/a
18 ccsbBroad304_06489 pLX_304 0% 71.1% 65% V5 (many diffs) n/a
19 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 71.1% 65% V5 (many diffs) n/a
20 ccsbBroadEn_00907 pDONR223 100% 69.1% 63.7% None (many diffs) n/a
21 ccsbBroad304_00907 pLX_304 0% 69.1% 63.7% V5 (many diffs) n/a
22 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 69.1% 63.7% V5 (many diffs) n/a
23 ccsbBroadEn_09418 pDONR223 100% 64.7% 58% None (many diffs) n/a
24 ccsbBroad304_09418 pLX_304 0% 64.7% 58% V5 (many diffs) n/a
25 ccsbBroadEn_13889 pDONR223 100% 60% 34.4% None (many diffs) n/a
26 ccsbBroadEn_00908 pDONR223 100% 60% 50.6% None (many diffs) n/a
27 ccsbBroad304_00908 pLX_304 0% 60% 50.6% V5 (many diffs) n/a
28 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 60% 50.6% V5 (many diffs) n/a
Download CSV