Transcript: LacZ.1

Hahn Lab Ecoli lacZ bGal reporter gene

LacZ (LacZ)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to LacZ.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other CONTROL Gene? Orig. Target Gene[?]
1 TRCN0000072236 CCAACGTGACCTATCCCATTA pLKO.1 290 CDS 100% 10.800 lacZ
2 TRCN0000231735 CCAACGTGACCTATCCCATTA pLKO_TRC005 290 CDS 100% 10.800 lacZ
3 TRCN0000072242 GTCGGCTTACGGCGGTGATTT pLKO.1 1743 CDS 100% 4.400 lacZ
4 TRCN0000231706 GTCGGCTTACGGCGGTGATTT pLKO_TRC005 1743 CDS 100% 4.400 lacZ
5 TRCN0000072238 GTTCCGTCATAGCGATAACGA pLKO.1 1917 CDS 100% 3.000 lacZ
6 TRCN0000231685 GTTCCGTCATAGCGATAACGA pLKO_TRC005 1917 CDS 100% 3.000 lacZ
7 TRCN0000072226 CGATCGTAATCACCCGAGTGT pLKO.1 1326 CDS 100% 2.640 lacZ
8 TRCN0000231709 CGATCGTAATCACCCGAGTGT pLKO_TRC005 1326 CDS 100% 2.640 lacZ
9 TRCN0000072231 CGCTAAATACTGGCAGGCGTT pLKO.1 1635 CDS 100% 2.160 lacZ
10 TRCN0000231710 CGCTAAATACTGGCAGGCGTT pLKO_TRC005 1635 CDS 100% 2.160 lacZ
11 TRCN0000072229 GCGATCGTAATCACCCGAGTG pLKO.1 1325 CDS 100% 0.750 lacZ
12 TRCN0000231712 GCGATCGTAATCACCCGAGTG pLKO_TRC005 1325 CDS 100% 0.750 lacZ
13 TRCN0000072224 CGCGATCGTAATCACCCGAGT pLKO.1 1324 CDS 100% 0.720 lacZ
14 TRCN0000231722 CGCGATCGTAATCACCCGAGT pLKO_TRC005 1324 CDS 100% 0.720 lacZ
15 TRCN0000072241 GCGTTGGCAATTTAACCGCCA pLKO.1 2250 CDS 100% 0.540 lacZ
16 TRCN0000231704 GCGTTGGCAATTTAACCGCCA pLKO_TRC005 2250 CDS 100% 0.540 lacZ
17 TRCN0000072223 TGTTCGCATTATCCGAACCAT pLKO.1 1153 CDS 100% 0.300 lacZ
18 TRCN0000231726 TGTTCGCATTATCCGAACCAT pLKO_TRC005 1153 CDS 100% 0.300 lacZ
19 TRCN0000072230 CCCGTCAGTATCGGCGGAATT pLKO.1 2988 CDS 100% 0.000 lacZ
20 TRCN0000231711 CCCGTCAGTATCGGCGGAATT pLKO_TRC005 2988 CDS 100% 0.000 lacZ
21 TRCN0000072237 CGCGCCTTTCGGCGGTGAAAT pLKO.1 801 CDS 100% 0.000 lacZ
22 TRCN0000231743 CGCGCCTTTCGGCGGTGAAAT pLKO_TRC005 801 CDS 100% 0.000 lacZ
23 TRCN0000072227 GCGCTAATCACGACGCGCTGT pLKO.1 1382 CDS 100% 0.000 lacZ
24 TRCN0000231708 GCGCTAATCACGACGCGCTGT pLKO_TRC005 1382 CDS 100% 0.000 lacZ
25 TRCN0000072235 CCGTCATAGCGATAACGAGTT pLKO.1 1920 CDS 100% 4.050 lacZ
26 TRCN0000231738 CCGTCATAGCGATAACGAGTT pLKO_TRC005 1920 CDS 100% 4.050 lacZ
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript LacZ.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?]
1 BRDN0000464771 pDONR223 0% 100% 100% None
2 ccsbBroad301_99994 pLX_TRC301 0% 100% 100% None
3 ccsbBroad301_99996 pLX_TRC301 0% 100% 100% None
4 ccsbBroad301_99995 pLX_TRC301 0% 100% 100% None
5 ccsbBroad301_99983 pLX_TRC301 0% 100% 100% None
6 ccsbBroad304_99994 pLX_TRC304 3.4% 100% 100% V5
7 ccsbBroad304_99995 pLX_TRC304 3.4% 100% 100% V5
8 ccsbBroad304_99996 pLX_TRC304 3.4% 100% 100% V5
9 BRDN0000556278 pLX_TRC305 0% 100% 100% None
10 BRDN0000556288 pLX_TRC306 0% 100% 100% V5
11 BRDN0000556266 pLXI_TRC401 0% 100% 100% None
12 BRDN0000556291 pLX_TRC311 0% 100% 100% V5
13 BRDN0000556274 pLX_TRC312 0% 100% 100% V5
14 BRDN0000556300 pLX_TRC313 0% 100% 100% V5
15 BRDN0000556279 pLX_TRC314 0% 100% 100% V5
16 BRDN0000556294 pLX_TRC315 0% 100% 100% V5
17 BRDN0000559461 TTTCATCGCCGATTTATTCTCTGG pLX_TRC317 14.2% 100% 100% V5
18 BRDN0000464772 pDONR223 0% 100% 100% None
19 BRDN0000464773 pDONR223 0% 100% 100% None
Download CSV