Transcript: Human NM_001351624.2

Homo sapiens mitogen-activated protein kinase 10 (MAPK10), transcript variant 7, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
MAPK10 (5602)
Length:
8752
CDS:
649..1929

Additional Resources:

NCBI RefSeq record:
NM_001351624.2
NBCI Gene record:
MAPK10 (5602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001351624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000194704 CATACAGCACTACTTACTTAG pLKO.1 2392 3UTR 100% 10.800 15.120 N MAPK10 n/a
2 TRCN0000433905 GTCAAGTCTGATTGCACATTG pLKO_005 1123 CDS 100% 10.800 15.120 N MAPK10 n/a
3 TRCN0000196303 GAATTAGACCATGAGCGAATG pLKO.1 1012 CDS 100% 6.000 8.400 N MAPK10 n/a
4 TRCN0000001021 CGACGCCTTACAGCATCCCTA pLKO.1 1587 CDS 100% 0.880 1.232 N MAPK10 n/a
5 TRCN0000432277 GCCTAGTCAGATGGATGTAGA pLKO_005 2347 3UTR 100% 4.950 3.960 N MAPK10 n/a
6 TRCN0000001020 GCCATTAAGAAGCTCAGCAGA pLKO.1 805 CDS 100% 2.640 2.112 N MAPK10 n/a
7 TRCN0000001938 GCCATTAAGAAGCTCAGCAGA pLKO.1 805 CDS 100% 2.640 2.112 N MAPK10 n/a
8 TRCN0000195168 CAAGTGGATGTGTCATATATT pLKO.1 613 5UTR 100% 15.000 10.500 N MAPK10 n/a
9 TRCN0000433496 GAATTATTCACAGGGATTTAA pLKO_005 1085 CDS 100% 15.000 10.500 N MAPK10 n/a
10 TRCN0000417287 ATGAAGTGTGTGAACCATAAA pLKO_005 877 CDS 100% 13.200 9.240 N MAPK10 n/a
11 TRCN0000194965 CCAAATGTTGTGTGGCATTAA pLKO.1 1047 CDS 100% 13.200 9.240 N MAPK10 n/a
12 TRCN0000194979 CCATTTCATGTGATCTATTAC pLKO.1 2476 3UTR 100% 13.200 9.240 N MAPK10 n/a
13 TRCN0000196370 GACAGAAATGTGGCCATTAAG pLKO.1 793 CDS 100% 13.200 9.240 N MAPK10 n/a
14 TRCN0000424750 GTATTGCAGCTAAGCTCAAAT pLKO_005 2107 3UTR 100% 13.200 9.240 N MAPK10 n/a
15 TRCN0000417185 GCCAGGGACTTGTTGTCAAAG pLKO_005 1528 CDS 100% 10.800 7.560 N MAPK10 n/a
16 TRCN0000422541 TGACCAGTGGAATAAGGTAAT pLKO_005 1341 CDS 100% 10.800 7.560 N MAPK10 n/a
17 TRCN0000001937 CCTTACAGCATCCCTACATCA pLKO.1 1592 CDS 100% 4.950 3.465 N MAPK10 n/a
18 TRCN0000001018 GTAAGAAACTATGTGGAGAAT pLKO.1 1414 CDS 100% 4.950 3.465 N MAPK10 n/a
19 TRCN0000001939 GTAAGAAACTATGTGGAGAAT pLKO.1 1414 CDS 100% 4.950 3.465 N MAPK10 n/a
20 TRCN0000001019 GCCGCGTATGATGCTGTCCTT pLKO.1 772 CDS 100% 0.880 0.616 N MAPK10 n/a
21 TRCN0000001941 CAATAAACTCAAAGCCAGCCA pLKO.1 1506 CDS 100% 0.660 0.462 N MAPK10 n/a
22 TRCN0000001017 CCAATGATGCTTACTACAGAA pLKO.1 2167 3UTR 100% 4.950 2.970 N MAPK10 n/a
23 TRCN0000001940 CCAATGATGCTTACTACAGAA pLKO.1 2167 3UTR 100% 4.950 2.970 N MAPK10 n/a
24 TRCN0000166364 CACACACACACACACACACAA pLKO.1 4813 3UTR 100% 4.950 2.475 Y KAAG1 n/a
25 TRCN0000162548 CACACACACACACACAAATAT pLKO.1 1998 3UTR 100% 15.000 7.500 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001351624.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487812 TGCAGATTATTTTACTCCTCGACG pLX_317 20.5% 91.4% 81.6% V5 (not translated due to prior stop codon) 0_1ins114;1135_1136insCAGCA n/a
2 TRCN0000488648 ACCAGGGTGAGTGAATCTAAGAAG pLX_317 20.3% 91.4% 81.6% V5 (not translated due to prior stop codon) 0_1ins114;1135_1136insCAGCA;1278_1279insG n/a
3 TRCN0000492117 CTAAGCTAACTACGGCGGTACGCC pLX_317 31.1% 82% 81.6% V5 (many diffs) n/a
4 TRCN0000491457 CCGTCCACGCTTTTACTCGGCAGT pLX_317 24.4% 82% 81.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_11057 pDONR223 100% 74.8% 74.8% None 1_321del n/a
6 ccsbBroad304_11057 pLX_304 0% 74.8% 74.8% V5 1_321del n/a
7 TRCN0000468220 CCCGCTATCGAACCGGGCATATAA pLX_317 45% 74.8% 74.8% V5 1_321del n/a
8 ccsbBroadEn_14805 pDONR223 0% 74.8% 74.8% None 1_321del n/a
9 ccsbBroad304_14805 pLX_304 0% 74.8% 74.8% V5 1_321del n/a
10 TRCN0000466133 TCATAAGCAAACAGGTTCCCACAG pLX_317 29.1% 74.8% 74.8% V5 1_321del n/a
11 ccsbBroadEn_11058 pDONR223 100% 72.6% 73% None (many diffs) n/a
12 ccsbBroad304_11058 pLX_304 0% 72.6% 73% V5 (many diffs) n/a
13 TRCN0000475774 GTGAGTTGCCAATCATGCAATTTA pLX_317 29% 72.6% 73% V5 (many diffs) n/a
14 TRCN0000489338 CTCATGACGTTAAATTTCAGTTAA pLX_317 28.4% 71.3% 82.1% V5 (many diffs) n/a
15 TRCN0000489471 GTGAGACGATACCTATTGCCACGT pLX_317 32.6% 71.3% 82.1% V5 (not translated due to prior stop codon) (many diffs) n/a
16 TRCN0000492156 AACAGCCTCTTGTTACGAGGTCTG pLX_317 19.2% 71.3% 82.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV