Transcript: Human XM_005244806.3

PREDICTED: Homo sapiens ATPase family AAA domain containing 3B (ATAD3B), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATAD3B (83858)
Length:
2029
CDS:
154..1914

Additional Resources:

NCBI RefSeq record:
XM_005244806.3
NBCI Gene record:
ATAD3B (83858)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005244806.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245163 TTTGACAACTGTGTTCTTAAG pLKO_005 1618 CDS 100% 10.800 7.560 N ATAD3B n/a
2 TRCN0000245162 TGCCATCAACAGCCGCATTGA pLKO_005 1536 CDS 100% 4.950 3.465 N ATAD3B n/a
3 TRCN0000245161 AGCGAGCCACTGAGGAGATAA pLKO_005 1409 CDS 100% 13.200 7.920 N ATAD3B n/a
4 TRCN0000245160 AGTCCAAGCTCAAAGAGTATG pLKO_005 422 CDS 100% 10.800 5.400 Y ATAD3B n/a
5 TRCN0000135268 CAAGGACAAATGGAGCAACTT pLKO.1 282 CDS 100% 4.950 2.475 Y ATAD3A n/a
6 TRCN0000148754 CAAGGACAAATGGAGCAACTT pLKO.1 282 CDS 100% 4.950 2.475 Y ATAD3B n/a
7 TRCN0000146443 CAGTCCAAGCTCAAAGAGTAT pLKO.1 421 CDS 100% 4.950 2.475 Y ATAD3B n/a
8 TRCN0000136856 CCAAGGACAAATGGAGCAACT pLKO.1 281 CDS 100% 4.050 2.025 Y ATAD3A n/a
9 TRCN0000243122 CAACCCTCATCCTGAGTCCAT pLKO_005 1900 CDS 100% 2.640 1.320 Y ATAD3C n/a
10 TRCN0000147113 CAATGAGGAGAATTTACGGAA pLKO.1 606 CDS 100% 2.640 1.320 Y ATAD3B n/a
11 TRCN0000133840 CAACTTCTCAATGAGGAGAAT pLKO.1 598 CDS 100% 0.495 0.248 Y ATAD3A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005244806.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15089 pDONR223 98.8% 95.9% 93.5% None (many diffs) n/a
2 ccsbBroad304_15089 pLX_304 0% 95.9% 93.5% V5 (many diffs) n/a
3 TRCN0000469079 GCACCGATTGGCAATGTGGAATAC pLX_317 27.2% 95.9% 93.5% V5 (many diffs) n/a
4 ccsbBroadEn_09121 pDONR223 100% 89.3% 88.1% None (many diffs) n/a
5 ccsbBroad304_09121 pLX_304 0% 89.3% 88.1% V5 (many diffs) n/a
6 TRCN0000475378 CCGTATGGCCACTCCGAGATAATT pLX_317 20.3% 89.3% 88.1% V5 (many diffs) n/a
7 ccsbBroadEn_12758 pDONR223 100% 77.6% 72.5% None (many diffs) n/a
8 ccsbBroad304_12758 pLX_304 0% 77.6% 72.5% V5 (many diffs) n/a
9 TRCN0000479707 ATCACGTGACTAGTTACTTAATGA pLX_317 19.8% 77.6% 72.5% V5 (many diffs) n/a
10 ccsbBroadEn_13403 pDONR223 100% 8.8% 4.4% None (many diffs) n/a
11 ccsbBroad304_13403 pLX_304 0% 8.8% 4.4% V5 (many diffs) n/a
12 TRCN0000469367 CCAGACGCTTTCCTAACCTTTACA pLX_317 100% 8.8% 4.4% V5 (many diffs) n/a
Download CSV