Transcript: Human XM_017027004.2

PREDICTED: Homo sapiens pregnancy specific beta-1-glycoprotein 9 (PSG9), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PSG9 (5678)
Length:
2435
CDS:
98..1585

Additional Resources:

NCBI RefSeq record:
XM_017027004.2
NBCI Gene record:
PSG9 (5678)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000244635 TAGAGAAGAAATTCGACATTT pLKO_005 490 CDS 100% 13.200 10.560 N PSG9 n/a
2 TRCN0000181053 CCTGGCTACTTCTGGTACAAA pLKO.1 284 CDS 100% 5.625 3.938 N PSG9 n/a
3 TRCN0000244632 CGAGGTGATGAGACTAGAGAA pLKO_005 476 CDS 100% 4.950 2.970 N PSG9 n/a
4 TRCN0000147479 GTCATCCTAAATGTCCTCTAT pLKO.1 1067 CDS 100% 4.950 2.970 N PSG9 n/a
5 TRCN0000150062 CCTACACCTTACACATCATAA pLKO.1 453 CDS 100% 13.200 6.600 Y PSG4 n/a
6 TRCN0000179922 CGGACCTCTACCATTACATTA pLKO.1 315 CDS 100% 13.200 6.600 Y PSG6 n/a
7 TRCN0000271462 CTACACCTTACACATCATAAA pLKO_005 454 CDS 100% 13.200 6.600 Y PSG5 n/a
8 TRCN0000271507 CTACCCAGTGTCACGAGAAAT pLKO_005 986 CDS 100% 13.200 6.600 Y PSG5 n/a
9 TRCN0000271460 TTACCCTTCATTCACCTATTA pLKO_005 1108 CDS 100% 13.200 6.600 Y PSG5 n/a
10 TRCN0000179823 CACCTACATTTGGTGGCTAAA pLKO.1 904 CDS 100% 10.800 5.400 Y PSG8 n/a
11 TRCN0000158405 CCCAGTGTCACGAGAAATGAA pLKO.1 989 CDS 100% 5.625 2.813 Y PSG3 n/a
12 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 732 CDS 100% 4.950 2.475 Y PSG2 n/a
13 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 732 CDS 100% 4.950 2.475 Y PSG7 n/a
14 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 732 CDS 100% 4.950 2.475 Y PSG1 n/a
15 TRCN0000155779 CTGTGAACCTAAGAGTGAGAA pLKO.1 880 CDS 100% 4.950 2.475 Y PSG5 n/a
16 TRCN0000156722 GCAGGACCCTATGAATGTGAA pLKO.1 731 CDS 100% 4.950 2.475 Y PSG3 n/a
17 TRCN0000183713 GTTCTTCTACTTGTCCACAAT pLKO.1 248 CDS 100% 4.950 2.475 Y PSG8 n/a
18 TRCN0000146886 CAAGGAAATCTCCAAATCCAT pLKO.1 1303 CDS 100% 3.000 1.500 Y PSG6 n/a
19 TRCN0000271508 ACCTACATTTGGTGGCTAAAT pLKO_005 905 CDS 100% 13.200 6.600 Y PSG5 n/a
20 TRCN0000148542 CGAGAAATGAAACAGGACCTT pLKO.1 999 CDS 100% 2.640 1.320 Y PSG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027004.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06792 pDONR223 100% 85.3% 83.3% None (many diffs) n/a
2 ccsbBroad304_06792 pLX_304 0% 85.3% 83.3% V5 (many diffs) n/a
3 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 85.3% 83.3% V5 (many diffs) n/a
4 ccsbBroadEn_06790 pDONR223 100% 80.8% 73.9% None (many diffs) n/a
5 ccsbBroad304_06790 pLX_304 0% 80.8% 73.9% V5 (many diffs) n/a
6 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 80.8% 73.9% V5 (many diffs) n/a
7 ccsbBroadEn_01306 pDONR223 100% 80.4% 75.1% None (many diffs) n/a
8 ccsbBroad304_01306 pLX_304 0% 80.4% 75.1% V5 (many diffs) n/a
9 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 80.4% 75.1% V5 (many diffs) n/a
10 ccsbBroadEn_05670 pDONR223 100% 80.3% 73.9% None (many diffs) n/a
11 ccsbBroad304_05670 pLX_304 0% 80.3% 73.9% V5 (many diffs) n/a
12 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 80.3% 73.9% V5 (many diffs) n/a
13 ccsbBroadEn_01305 pDONR223 100% 78% 71.1% None (many diffs) n/a
14 ccsbBroad304_01305 pLX_304 0% 78% 71.1% V5 (many diffs) n/a
15 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 78% 71.1% V5 (many diffs) n/a
16 ccsbBroadEn_11063 pDONR223 100% 77.8% 71.5% None (many diffs) n/a
17 ccsbBroad304_11063 pLX_304 0% 77.8% 71.5% V5 (many diffs) n/a
18 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 77.8% 71.5% V5 (many diffs) n/a
19 ccsbBroadEn_06791 pDONR223 100% 61.9% 55.3% None (many diffs) n/a
20 ccsbBroad304_06791 pLX_304 0% 61.9% 55.3% V5 (many diffs) n/a
21 TRCN0000491658 GAGACGTGCGACATTCGGCGTTTC pLX_317 40.1% 61.9% 55.3% V5 (many diffs) n/a
22 ccsbBroadEn_13930 pDONR223 100% 61.6% 53.6% None (many diffs) n/a
23 ccsbBroad304_13930 pLX_304 0% 61.6% 53.6% V5 (not translated due to frame shift) (many diffs) n/a
24 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 61.6% 53.6% V5 (not translated due to frame shift) (many diffs) n/a
25 ccsbBroadEn_06793 pDONR223 100% 37.9% 31.7% None (many diffs) n/a
26 ccsbBroad304_06793 pLX_304 0% 37.9% 31.7% V5 (many diffs) n/a
27 TRCN0000475187 CAACATGAGCTAGTACCTTGAGAG pLX_317 68.6% 37.9% 31.7% V5 (many diffs) n/a
Download CSV