Transcript: Human NM_001083538.2

Homo sapiens POTE ankyrin domain family member E (POTEE), mRNA.

Source:
NCBI, updated 2019-09-30
Taxon:
Homo sapiens (human)
Gene:
POTEE (445582)
Length:
3916
CDS:
94..3321

Additional Resources:

NCBI RefSeq record:
NM_001083538.2
NBCI Gene record:
POTEE (445582)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001083538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000142639 GTGAACAAGAAGGACAAGCAA pLKO.1 589 CDS 100% 3.000 1.800 N POTEE n/a
2 TRCN0000254475 CAATGGTGATGATGGATTAAT pLKO_005 1782 CDS 100% 15.000 7.500 Y POTEC n/a
3 TRCN0000142532 GCCAAAGCACTGCTCTTATAT pLKO.1 856 CDS 100% 15.000 7.500 Y POTEE n/a
4 TRCN0000262863 TTGGCTTGACTCAGGATTTAA pLKO_005 3441 3UTR 100% 15.000 7.500 Y POTEF n/a
5 TRCN0000262862 CTCTGCACTACGCTATCTATA pLKO_005 818 CDS 100% 13.200 6.600 Y POTEF n/a
6 TRCN0000262861 GAAGATGAATGTGCGTTAATG pLKO_005 745 CDS 100% 13.200 6.600 Y POTEF n/a
7 TRCN0000262860 GACAGACGATGTCAACTTAAT pLKO_005 673 CDS 100% 13.200 6.600 Y POTEF n/a
8 TRCN0000141790 GCAACCCAGAACAAGACTTAA pLKO.1 1565 CDS 100% 13.200 6.600 Y POTEE n/a
9 TRCN0000145107 GCAATGGTGATGATGGATTAA pLKO.1 1781 CDS 100% 13.200 6.600 Y POTEE n/a
10 TRCN0000148153 GCAATGGTGATGATGGATTAA pLKO.1 1781 CDS 100% 13.200 6.600 Y POTED n/a
11 TRCN0000145382 GCTCTTATATGGTGCTGATAT pLKO.1 867 CDS 100% 13.200 6.600 Y POTEE n/a
12 TRCN0000148072 GCTCTTATATGGTGCTGATAT pLKO.1 867 CDS 100% 13.200 6.600 Y POTED n/a
13 TRCN0000265540 GGACAGACGATGTCAACTTAA pLKO_005 672 CDS 100% 13.200 6.600 Y POTEC n/a
14 TRCN0000150907 GAAGAACAGAACACTGGAATA pLKO.1 1906 CDS 100% 10.800 5.400 Y POTEG n/a
15 TRCN0000436448 GTTGTGGATCAGCAAGTATAG pLKO_005 1034 CDS 100% 10.800 5.400 Y POTEB3 n/a
16 TRCN0000418180 TCTGATAAAGGCCGTACAATG pLKO_005 720 CDS 100% 10.800 5.400 Y POTEB3 n/a
17 TRCN0000435056 TGTATCTTCTCAAGATCTATC pLKO_005 1083 CDS 100% 10.800 5.400 Y POTEB3 n/a
18 TRCN0000146483 CCAGAGAGTATGCTGTTTCTA pLKO.1 1115 CDS 100% 5.625 2.813 Y POTED n/a
19 TRCN0000155986 CCAGAGAGTATGCTGTTTCTA pLKO.1 1115 CDS 100% 5.625 2.813 Y POTEG n/a
20 TRCN0000117346 CATCACCAACTGGGATGACAT pLKO.1 2418 CDS 100% 4.950 2.475 Y ACTA1 n/a
21 TRCN0000144012 CCAGTTACTTTCTGACTACAA pLKO.1 1155 CDS 100% 4.950 2.475 Y POTEE n/a
22 TRCN0000150726 CCAGTTACTTTCTGACTACAA pLKO.1 1155 CDS 100% 4.950 2.475 Y POTEG n/a
23 TRCN0000029409 CGAGAAGATGACCCAGATCAT pLKO.1 2541 CDS 100% 4.950 2.475 Y ACTB n/a
24 TRCN0000276219 CGAGAAGATGACCCAGATCAT pLKO_005 2541 CDS 100% 4.950 2.475 Y ACTB n/a
25 TRCN0000090901 CGTGCGTGACATCAAAGAGAA pLKO.1 2817 CDS 100% 4.950 2.475 Y Actb n/a
26 TRCN0000309123 CGTGCGTGACATCAAAGAGAA pLKO_005 2817 CDS 100% 4.950 2.475 Y Actb n/a
27 TRCN0000140774 GAAGACACTCAGGAGCAAGAT pLKO.1 255 CDS 100% 4.950 2.475 Y POTEE n/a
28 TRCN0000157596 GAAGACACTCAGGAGCAAGAT pLKO.1 255 CDS 100% 4.950 2.475 Y POTEH n/a
29 TRCN0000144603 GAGTATGCTGTTTCTAGTCAT pLKO.1 1120 CDS 100% 4.950 2.475 Y POTEE n/a
30 TRCN0000140286 GCTCTGATAAAGGCCGTACAA pLKO.1 718 CDS 100% 4.950 2.475 Y POTEE n/a
31 TRCN0000154872 CAGAAAGGATCTCATCGTCAT pLKO.1 552 CDS 100% 4.050 2.025 Y POTEH n/a
32 TRCN0000146454 CTGCTCTTATATGGTGCTGAT pLKO.1 865 CDS 100% 4.050 2.025 Y POTED n/a
33 TRCN0000117202 GACTCTGACTTAGTTGCGTTA pLKO.1 3325 3UTR 100% 4.050 2.025 Y POTEKP n/a
34 TRCN0000090902 CCAGATCATGTTTGAGACCTT pLKO.1 2553 CDS 100% 2.640 1.320 Y Actb n/a
35 TRCN0000157939 CCAGGAAGATGAATGTGCGTT pLKO.1 741 CDS 100% 2.640 1.320 Y POTEH n/a
36 TRCN0000139685 CGACTCTGCTATGAAGACACT pLKO.1 243 CDS 100% 2.640 1.320 Y POTEE n/a
37 TRCN0000158296 CGACTCTGCTATGAAGACACT pLKO.1 243 CDS 100% 2.640 1.320 Y POTEH n/a
38 TRCN0000117205 CCCTCCATTGTCCACCGCAAA pLKO.1 3292 CDS 100% 1.350 0.675 Y POTEKP n/a
39 TRCN0000142004 GCGTTAATGTTGCTGGAACAT pLKO.1 757 CDS 100% 0.495 0.248 Y POTEE n/a
40 TRCN0000154676 GCGTTAATGTTGCTGGAACAT pLKO.1 757 CDS 100% 0.495 0.248 Y POTEG n/a
41 TRCN0000337296 GAAGCACGGAAGTACTCATAT pLKO_005 1722 CDS 100% 13.200 6.600 Y POTEM n/a
42 TRCN0000254474 TCTTATATGGTGCTGATATTG pLKO_005 869 CDS 100% 13.200 6.600 Y POTEC n/a
43 TRCN0000421750 GACAGACGATGTCAACTTAAC pLKO_005 673 CDS 100% 10.800 5.400 Y POTEB3 n/a
44 TRCN0000089842 TGTGCTATGTTGCCCTGGATT pLKO.1 2840 CDS 100% 4.950 2.475 Y Actg-ps1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001083538.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10007 pDONR223 100% 49.6% 46.8% None (many diffs) n/a
2 ccsbBroad304_10007 pLX_304 0% 49.6% 46.8% V5 (many diffs) n/a
3 TRCN0000470029 CGGTCGAATCTTAACATCGCAATG pLX_317 21.7% 49.6% 46.8% V5 (many diffs) n/a
4 ccsbBroadEn_16159 pDONR223 0% 32.9% 32% None (many diffs) n/a
5 ccsbBroad304_16159 pLX_304 0% 32.9% 32% V5 (many diffs) n/a
6 TRCN0000481035 CTCACAAGTATCCACCTTTAGCGG pLX_317 40.3% 32.9% 32% V5 (many diffs) n/a
7 ccsbBroadEn_13645 pDONR223 100% 32.7% 31.8% None (many diffs) n/a
8 ccsbBroad304_13645 pLX_304 0% 32.7% 31.8% V5 (many diffs) n/a
9 TRCN0000475599 CTACCGATTGCATGCTTACATGGA pLX_317 15.6% 32.7% 31.8% V5 (many diffs) n/a
10 ccsbBroadEn_05763 pDONR223 100% 32.3% 32% None (many diffs) n/a
11 ccsbBroad304_05763 pLX_304 53.1% 32.3% 32% V5 (many diffs) n/a
12 TRCN0000470279 TCAAGCCTGGAACGGGCTCACGTC pLX_317 31.7% 32.3% 32% V5 (many diffs) n/a
13 ccsbBroadEn_15351 pDONR223 0% 30.8% 31.9% None (many diffs) n/a
14 ccsbBroad304_15351 pLX_304 0% 30.8% 31.9% V5 (many diffs) n/a
15 ccsbBroadEn_13808 pDONR223 100% 30.8% 31.7% None (many diffs) n/a
16 ccsbBroad304_13808 pLX_304 0% 30.8% 31.7% V5 (not translated due to frame shift) (many diffs) n/a
17 TRCN0000471742 AATGGGAGTTCTCACGTCAGGTCC pLX_317 44.8% 30.8% 31.7% V5 (not translated due to frame shift) (many diffs) n/a
18 ccsbBroadEn_05764 pDONR223 100% 30.8% 31.9% None (many diffs) n/a
19 ccsbBroad304_05764 pLX_304 0% 30.8% 31.9% V5 (many diffs) n/a
20 TRCN0000466781 AATTGTGGTGCTTGTTGCCGCCTG pLX_317 31.7% 30.8% 31.9% V5 (many diffs) n/a
21 ccsbBroadEn_00015 pDONR223 100% 29.1% 30.5% None (many diffs) n/a
22 ccsbBroad304_00015 pLX_304 0% 29.1% 30.5% V5 (many diffs) n/a
23 TRCN0000468012 TCTATATTCTTCCCTCACTCATAA pLX_317 37.9% 29.1% 30.5% V5 (many diffs) n/a
24 ccsbBroadEn_00014 pDONR223 100% 28.7% 30.4% None (many diffs) n/a
25 ccsbBroad304_00014 pLX_304 0% 28.7% 30.4% V5 (not translated due to prior stop codon) (many diffs) n/a
26 TRCN0000467679 GCTACTGCTTTGAGGGTTATAACT pLX_317 37.9% 28.7% 30.4% V5 (not translated due to prior stop codon) (many diffs) n/a
27 ccsbBroadEn_14514 pDONR223 100% 17.6% 14.7% None (many diffs) n/a
28 ccsbBroad304_14514 pLX_304 0% 17.6% 14.7% V5 (not translated due to frame shift) (many diffs) n/a
29 TRCN0000481436 GCTCGTTTACTAGTATTTTTAATC pLX_317 64.2% 17.6% 14.7% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV