Transcript: Human NM_001172671.2

Homo sapiens zinc finger protein 430 (ZNF430), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF430 (80264)
Length:
3883
CDS:
145..1854

Additional Resources:

NCBI RefSeq record:
NM_001172671.2
NBCI Gene record:
ZNF430 (80264)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001172671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421528 AGCCTCTAACCCGTCCTGAAT pLKO_005 1867 3UTR 100% 4.950 3.960 N ZNF430 n/a
2 TRCN0000416163 CAACTACCCAGAGTGAAATAT pLKO_005 650 CDS 100% 15.000 10.500 N ZNF430 n/a
3 TRCN0000017699 CCTAGAATGTGATAAAGCCTT pLKO.1 1686 CDS 100% 2.640 1.848 N ZNF430 n/a
4 TRCN0000431398 ACTTACTGCACATAAGGTAAT pLKO_005 1554 CDS 100% 10.800 6.480 N ZNF430 n/a
5 TRCN0000017698 CTGCACAAAGAATGTTATGAT pLKO.1 610 CDS 100% 5.625 3.375 N ZNF430 n/a
6 TRCN0000420499 CTTACCAGACATAAGATAATT pLKO_005 1973 3UTR 100% 15.000 7.500 Y ZNF430 n/a
7 TRCN0000344389 ACCTTACTGCACATAAGATAA pLKO_005 1469 CDS 100% 13.200 6.600 Y ZNF737 n/a
8 TRCN0000017700 CCCAGTTACATATTCTCATTT pLKO.1 459 CDS 100% 13.200 6.600 Y ZNF430 n/a
9 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 965 CDS 100% 13.200 6.600 Y ZNF98 n/a
10 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 908 CDS 100% 13.200 6.600 Y Zfp934 n/a
11 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 908 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
12 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 908 CDS 100% 13.200 6.600 Y EG668616 n/a
13 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 2083 3UTR 100% 13.200 6.600 Y IQCC n/a
14 TRCN0000421971 TTACACCTAACTCAACATAAA pLKO_005 793 CDS 100% 13.200 6.600 Y ZNF430 n/a
15 TRCN0000017701 CCAGTCTTCAACTCTTACTAA pLKO.1 1710 CDS 100% 5.625 2.813 Y ZNF430 n/a
16 TRCN0000149130 GCTGGAGAGAAACCTTACAAA pLKO.1 1243 CDS 100% 5.625 2.813 Y ZNF761 n/a
17 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 2015 3UTR 100% 4.950 2.475 Y CFLAR n/a
18 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 2015 3UTR 100% 4.950 2.475 Y C19orf31 n/a
19 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 421 CDS 100% 4.950 2.475 Y ZNF430 n/a
20 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 333 CDS 100% 4.950 2.475 Y ZNF493 n/a
21 TRCN0000430017 CCAGTCCTCAAACCTTATTAA pLKO_005 1794 CDS 100% 15.000 7.500 Y ZNF431 n/a
22 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 1133 CDS 100% 13.200 6.600 Y ZNF98 n/a
23 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 2180 3UTR 100% 10.800 5.400 Y SMIM11A n/a
24 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 2013 3UTR 100% 4.950 2.475 Y ERN2 n/a
25 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 2013 3UTR 100% 4.950 2.475 Y P3H4 n/a
26 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 2013 3UTR 100% 4.950 2.475 Y P3H4 n/a
27 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1249 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001172671.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15167 pDONR223 53.6% 99.7% 50.7% None 866G>A;871G>T;1675_1676delAGinsGA n/a
2 ccsbBroad304_15167 pLX_304 0% 99.7% 50.7% V5 (not translated due to prior stop codon) 866G>A;871G>T;1675_1676delAGinsGA n/a
3 ccsbBroadEn_09784 pDONR223 100% 87.6% 78.2% None (many diffs) n/a
4 ccsbBroad304_09784 pLX_304 0% 87.6% 78.2% V5 (many diffs) n/a
5 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 87.6% 78.2% V5 (many diffs) n/a
6 ccsbBroadEn_15273 pDONR223 50.9% 85.8% 78.2% None (many diffs) n/a
7 ccsbBroad304_15273 pLX_304 0% 85.8% 78.2% V5 (many diffs) n/a
8 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 40.7% 35.4% V5 (not translated due to frame shift) (many diffs) n/a
9 ccsbBroadEn_10024 pDONR223 100% 75.8% 65.7% None (many diffs) n/a
10 ccsbBroad304_10024 pLX_304 0% 75.8% 65.7% V5 (many diffs) n/a
11 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 75.8% 65.7% V5 (many diffs) n/a
12 ccsbBroadEn_15278 pDONR223 59.5% 75% 64.1% None (many diffs) n/a
13 ccsbBroad304_15278 pLX_304 0% 75% 64.1% V5 (many diffs) n/a
14 ccsbBroadEn_09655 pDONR223 100% 73.3% 62.9% None (many diffs) n/a
15 ccsbBroad304_09655 pLX_304 0% 73.3% 62.9% V5 (many diffs) n/a
16 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 73.3% 62.9% V5 (many diffs) n/a
17 ccsbBroadEn_02188 pDONR223 100% 69.3% 60.2% None (many diffs) n/a
18 ccsbBroad304_02188 pLX_304 0% 69.3% 60.2% V5 (many diffs) n/a
19 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 69.3% 60.2% V5 (many diffs) n/a
20 ccsbBroadEn_09774 pDONR223 100% 65.2% 54.4% None (many diffs) n/a
21 ccsbBroad304_09774 pLX_304 0% 65.2% 54.4% V5 (many diffs) n/a
22 TRCN0000472815 CCTGACTCCCTTTAAGTGTTCGTG pLX_317 27.4% 65.2% 54.4% V5 (many diffs) n/a
23 ccsbBroadEn_07157 pDONR223 100% 54.9% 45% None (many diffs) n/a
24 ccsbBroad304_07157 pLX_304 0% 54.9% 45% V5 (many diffs) n/a
25 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 54.9% 45% V5 (many diffs) n/a
26 ccsbBroadEn_15729 pDONR223 0% 12.8% 11.9% None (many diffs) n/a
27 ccsbBroad304_15729 pLX_304 0% 12.8% 11.9% V5 (many diffs) n/a
28 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 12.8% 11.9% V5 (many diffs) n/a
29 ccsbBroadEn_13746 pDONR223 100% 11.8% 11% None (many diffs) n/a
30 ccsbBroad304_13746 pLX_304 0% 11.8% 11% V5 (many diffs) n/a
31 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 11.8% 11% V5 (many diffs) n/a
Download CSV