Transcript: Human NM_001282716.1

Homo sapiens stromal antigen 3 (STAG3), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-07
Taxon:
Homo sapiens (human)
Gene:
STAG3 (10734)
Length:
4313
CDS:
247..3924

Additional Resources:

NCBI RefSeq record:
NM_001282716.1
NBCI Gene record:
STAG3 (10734)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001282716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000230168 CCGCAGCCAGCTAGTAGATTT pLKO_005 2244 CDS 100% 13.200 18.480 N STAG3 n/a
2 TRCN0000137596 CGTGATTTCCTTAGGCCACTT pLKO.1 2701 CDS 100% 4.050 5.670 N STAG3 n/a
3 TRCN0000230167 ATCCAATCTTGCGGATGTAAA pLKO_005 658 CDS 100% 13.200 9.240 N STAG3 n/a
4 TRCN0000230169 GTGATCTACTTCTCATCTTTA pLKO_005 2657 CDS 100% 13.200 9.240 N STAG3 n/a
5 TRCN0000230170 TGATTCCCAGGAGGATCATTT pLKO_005 2811 CDS 100% 13.200 9.240 N STAG3 n/a
6 TRCN0000134797 CAGGAGGATCATTTACAGATA pLKO.1 2818 CDS 100% 4.950 3.465 N STAG3 n/a
7 TRCN0000138271 CCAGCCTTGACTCTTGTCTAT pLKO.1 2476 CDS 100% 4.950 3.465 N STAG3 n/a
8 TRCN0000135354 GCTGATGAAGACACTGACTTT pLKO.1 382 CDS 100% 4.950 3.465 N STAG3 n/a
9 TRCN0000135820 CATCCAATCTTGCGGATGTAA pLKO.1 657 CDS 100% 0.563 0.394 N STAG3 n/a
10 TRCN0000219103 CACCTAACAGAGCAGTTTAAT pLKO_005 733 CDS 100% 15.000 9.000 N STAG3 n/a
11 TRCN0000135230 CAAGAGCATCAAGAGGAGATT pLKO.1 1117 CDS 100% 4.950 2.970 N STAG3 n/a
12 TRCN0000121694 CCTCACCGACAGCTATTTAAA pLKO.1 1263 CDS 100% 15.000 7.500 Y STAG3L3 n/a
13 TRCN0000062692 GCTATCTGCATTGAGGAAATT pLKO.1 1210 CDS 100% 13.200 6.600 Y STAG3L1 n/a
14 TRCN0000139360 CAGCTTCTGCTGTCCTTCTTT pLKO.1 1681 CDS 100% 5.625 2.813 Y STAG3L3 n/a
15 TRCN0000139995 GAGATCCGTGCTATCTGCATT pLKO.1 1201 CDS 100% 4.950 2.475 Y STAG3L3 n/a
16 TRCN0000062691 GCAAAGCTACAGCACGTCTTT pLKO.1 1242 CDS 100% 4.950 2.475 Y STAG3L1 n/a
17 TRCN0000122408 GCAAAGCTACAGCACGTCTTT pLKO.1 1242 CDS 100% 4.950 2.475 Y STAG3L3 n/a
18 TRCN0000138869 GCAAAGCTACAGCACGTCTTT pLKO.1 1242 CDS 100% 4.950 2.475 Y STAG3 n/a
19 TRCN0000137748 GCAGGATTTCTGGAGCTTGTT pLKO.1 628 CDS 100% 4.950 2.475 Y STAG3 n/a
20 TRCN0000139256 CTGCATGATAAGCACCGAGAA pLKO.1 1300 CDS 100% 4.050 2.025 Y STAG3L3 n/a
21 TRCN0000140844 CAGAGGACTTTCTTCCAGCTT pLKO.1 1666 CDS 100% 2.640 1.320 Y STAG3L3 n/a
22 TRCN0000165549 GATGCAGGATTTCTGGAGCTT pLKO.1 625 CDS 100% 2.640 1.320 Y STAG3L4 n/a
23 TRCN0000167398 GAATTTCTGTACTGGAAACTT pLKO.1 1582 CDS 100% 5.625 2.813 Y STAG3L2 n/a
24 TRCN0000062690 CGCTGCTTACTTAGTAGACAA pLKO.1 1725 CDS 100% 4.950 2.475 Y STAG3L1 n/a
25 TRCN0000167941 CGCTGCTTACTTAGTAGACAA pLKO.1 1725 CDS 100% 4.950 2.475 Y STAG3L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001282716.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07670 pDONR223 100% 99.9% 99.8% None 48G>T;106A>C;1293A>C n/a
2 ccsbBroad304_07670 pLX_304 0% 99.9% 99.8% V5 48G>T;106A>C;1293A>C n/a
3 TRCN0000476860 CATCCTAGTGCATTCGAGCCGTGA pLX_317 11.7% 99.9% 99.8% V5 48G>T;106A>C;1293A>C n/a
4 ccsbBroadEn_03986 pDONR223 100% 11.6% 9.1% None (many diffs) n/a
5 ccsbBroad304_03986 pLX_304 0% 11.6% 9.1% V5 (many diffs) n/a
6 TRCN0000469741 AGGAAACCCGCCGAGAAACTTGGA pLX_317 75.9% 11.6% 9.1% V5 (many diffs) n/a
7 ccsbBroadEn_10171 pDONR223 100% 9.7% 9.2% None (many diffs) n/a
8 ccsbBroad304_10171 pLX_304 0% 9.7% 9.2% V5 (many diffs) n/a
9 TRCN0000474301 GGCATGATAACGCGACACGTACAC pLX_317 60.6% 9.7% 9.2% V5 (many diffs) n/a
10 ccsbBroadEn_13704 pDONR223 100% 6% 5.5% None (many diffs) n/a
11 ccsbBroad304_13704 pLX_304 0% 6% 5.5% V5 (many diffs) n/a
12 ccsbBroadEn_12038 pDONR223 100% 5.9% 4.9% None (many diffs) n/a
13 ccsbBroad304_12038 pLX_304 0% 5.9% 4.9% V5 (many diffs) n/a
14 TRCN0000471778 CAAGTTTGACTAGCTTGAAGTGGC pLX_317 100% 5.9% 4.9% V5 (many diffs) n/a
Download CSV