Transcript: Human NM_001291696.1

Homo sapiens killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 2 (KIR2DS2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
KIR2DS2 (100132285)
Length:
1273
CDS:
36..650

Additional Resources:

NCBI RefSeq record:
NM_001291696.1
NBCI Gene record:
KIR2DS2 (100132285)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001291696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243133 GGAGGTGTCATACGCATAATT pLKO_005 632 CDS 100% 15.000 7.500 Y KIR3DS1 n/a
2 TRCN0000435229 GAGGTGTCATACGCATAATTG pLKO_005 633 CDS 100% 13.200 6.600 Y KIR2DS4 n/a
3 TRCN0000428282 GCCTCTCTCTTGCTTACAAAT pLKO_005 939 3UTR 100% 13.200 6.600 Y KIR2DL1 n/a
4 TRCN0000057032 GTCACAGGAAACCCTTCAAAT pLKO.1 393 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
5 TRCN0000421852 TCCTTTGCTTAGCCCACAATT pLKO_005 998 3UTR 100% 13.200 6.600 Y KIR2DS5 n/a
6 TRCN0000418745 AGGCATCAGTCTTCATCTTAG pLKO_005 883 3UTR 100% 10.800 5.400 Y KIR2DS5 n/a
7 TRCN0000243132 CTATGACATGTACCATCTATC pLKO_005 197 CDS 100% 10.800 5.400 Y KIR3DS1 n/a
8 TRCN0000057030 CCTATGACATGTACCATCTAT pLKO.1 196 CDS 100% 5.625 2.813 Y KIR2DS2 n/a
9 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 320 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
10 TRCN0000056930 CTCCTCTTCTTTCTCCTTCAT pLKO.1 513 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
11 TRCN0000056929 GCTTGTTTCTGTCACAGGAAA pLKO.1 383 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
12 TRCN0000063691 TGCAGGGAACAGAACAGTGAA pLKO.1 581 CDS 100% 4.950 2.475 Y KIR2DL3 n/a
13 TRCN0000061717 TCAGGAGGTGTCATACGCATA pLKO.1 629 CDS 100% 4.050 2.025 Y KIR2DS3 n/a
14 TRCN0000056990 GATTCTGATGAACAAGACCAT pLKO.1 609 CDS 100% 2.640 1.320 Y KIR2DS1 n/a
15 TRCN0000063023 CCTCCTCTTCTTTCTCCTTTA pLKO.1 512 CDS 100% 10.800 5.400 Y KIR3DL2 n/a
16 TRCN0000417192 TTGGGACCTCAGTGGTCAAAC pLKO_005 478 CDS 100% 10.800 5.400 Y KIR2DS5 n/a
17 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 378 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001291696.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13888 pDONR223 100% 64.8% 4.4% None (many diffs) n/a
2 ccsbBroad304_13888 pLX_304 0% 64.8% 4.4% V5 (not translated due to prior stop codon) (many diffs) n/a
3 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 64.8% 4.4% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 64.8% 50.6% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_14687 pDONR223 73.4% 64.3% 49.6% None (many diffs) n/a
6 ccsbBroad304_14687 pLX_304 0% 64.3% 49.6% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 64.3% 49.6% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_13754 pDONR223 100% 58.5% 55.3% None (many diffs) n/a
9 ccsbBroad304_13754 pLX_304 0% 58.5% 55.3% V5 (many diffs) n/a
10 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 58.5% 55.3% V5 (many diffs) n/a
11 ccsbBroadEn_06487 pDONR223 100% 57.8% 56% None (many diffs) n/a
12 ccsbBroad304_06487 pLX_304 0% 57.8% 56% V5 (many diffs) n/a
13 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 57.8% 56% V5 (many diffs) n/a
14 ccsbBroadEn_10936 pDONR223 100% 51.4% 49.8% None (many diffs) n/a
15 ccsbBroad304_10936 pLX_304 0% 51.4% 49.8% V5 (many diffs) n/a
16 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 51.4% 49.8% V5 (many diffs) n/a
17 ccsbBroadEn_06488 pDONR223 100% 48% 41.1% None (many diffs) n/a
18 ccsbBroad304_06488 pLX_304 0% 48% 41.1% V5 (many diffs) n/a
19 TRCN0000480702 ACTCACGGACTGCAGTACACGCGC pLX_317 26.5% 48% 41.1% V5 (many diffs) n/a
20 ccsbBroadEn_13889 pDONR223 100% 42.5% 15.4% None (many diffs) n/a
21 ccsbBroadEn_00908 pDONR223 100% 42.5% 35% None (many diffs) n/a
22 ccsbBroad304_00908 pLX_304 0% 42.5% 35% V5 (many diffs) n/a
23 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 42.5% 35% V5 (many diffs) n/a
24 ccsbBroadEn_06489 pDONR223 100% 41.1% 36.4% None (many diffs) n/a
25 ccsbBroad304_06489 pLX_304 0% 41.1% 36.4% V5 (many diffs) n/a
26 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 41.1% 36.4% V5 (many diffs) n/a
27 ccsbBroadEn_00907 pDONR223 100% 39.9% 34.9% None (many diffs) n/a
28 ccsbBroad304_00907 pLX_304 0% 39.9% 34.9% V5 (many diffs) n/a
29 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 39.9% 34.9% V5 (many diffs) n/a
30 ccsbBroadEn_09418 pDONR223 100% 37.6% 35.1% None (many diffs) n/a
31 ccsbBroad304_09418 pLX_304 0% 37.6% 35.1% V5 (many diffs) n/a
Download CSV