Transcript: Human NM_138286.3

Homo sapiens zinc finger protein 681 (ZNF681), mRNA.

Source:
NCBI, updated 2019-05-02
Taxon:
Homo sapiens (human)
Gene:
ZNF681 (148213)
Length:
6497
CDS:
143..2080

Additional Resources:

NCBI RefSeq record:
NM_138286.3
NBCI Gene record:
ZNF681 (148213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_138286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421020 ACACTATACAGCAGAATTTAT pLKO_005 207 CDS 100% 15.000 10.500 N ZNF681 n/a
2 TRCN0000417904 AGACACACATTATGAACATAA pLKO_005 2396 3UTR 100% 13.200 9.240 N ZNF681 n/a
3 TRCN0000421986 TTTCACCAGAGCAGAACATAA pLKO_005 396 CDS 100% 13.200 9.240 N ZNF681 n/a
4 TRCN0000415149 GTCACACTTGATTGTGCATAA pLKO_005 2115 3UTR 100% 10.800 7.560 N ZNF681 n/a
5 TRCN0000019455 CCAGAGAGAAACTCAATGAAT pLKO.1 1056 CDS 100% 5.625 3.938 N ZNF681 n/a
6 TRCN0000019454 CGTCACACATTACAACACATA pLKO.1 939 CDS 100% 4.950 3.465 N ZNF681 n/a
7 TRCN0000019458 CCTCAAACCTTACTGGACATA pLKO.1 1947 CDS 100% 4.950 2.970 N ZNF681 n/a
8 TRCN0000420499 CTTACCAGACATAAGATAATT pLKO_005 1115 CDS 100% 15.000 7.500 Y ZNF430 n/a
9 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 861 CDS 100% 13.200 6.600 Y ZNF98 n/a
10 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1029 CDS 100% 13.200 6.600 Y ZNF98 n/a
11 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1140 CDS 100% 13.200 6.600 Y Zfp934 n/a
12 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1140 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
13 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1140 CDS 100% 13.200 6.600 Y EG668616 n/a
14 TRCN0000019456 ACCTTACTAGACATAAGAGAA pLKO.1 1869 CDS 100% 4.950 2.475 Y ZNF681 n/a
15 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 1359 CDS 100% 4.950 2.475 Y ZNF681 n/a
16 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 238 CDS 100% 4.950 2.475 Y ZNF493 n/a
17 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 280 CDS 100% 4.050 2.025 Y ZNF273 n/a
18 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3440 3UTR 100% 5.625 2.813 Y KLHL30 n/a
19 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1173 CDS 100% 4.950 2.475 Y ZNF714 n/a
20 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3440 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_138286.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09655 pDONR223 100% 70.2% 60.6% None (many diffs) n/a
2 ccsbBroad304_09655 pLX_304 0% 70.2% 60.6% V5 (many diffs) n/a
3 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 70.2% 60.6% V5 (many diffs) n/a
4 ccsbBroadEn_09784 pDONR223 100% 68.8% 58.1% None (many diffs) n/a
5 ccsbBroad304_09784 pLX_304 0% 68.8% 58.1% V5 (many diffs) n/a
6 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 68.8% 58.1% V5 (many diffs) n/a
7 ccsbBroadEn_15167 pDONR223 53.6% 68.5% 28.1% None (many diffs) n/a
8 ccsbBroad304_15167 pLX_304 0% 68.5% 28.1% V5 (not translated due to prior stop codon) (many diffs) n/a
9 ccsbBroadEn_07157 pDONR223 100% 68.5% 57.6% None (many diffs) n/a
10 ccsbBroad304_07157 pLX_304 0% 68.5% 57.6% V5 (many diffs) n/a
11 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 68.5% 57.6% V5 (many diffs) n/a
12 ccsbBroadEn_10024 pDONR223 100% 67.3% 57.8% None (many diffs) n/a
13 ccsbBroad304_10024 pLX_304 0% 67.3% 57.8% V5 (many diffs) n/a
14 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 67.3% 57.8% V5 (many diffs) n/a
15 ccsbBroadEn_11550 pDONR223 100% 66.8% 58.6% None (many diffs) n/a
16 ccsbBroad304_11550 pLX_304 0% 66.8% 58.6% V5 (many diffs) n/a
17 ccsbBroadEn_08635 pDONR223 100% 65.7% 54.9% None (many diffs) n/a
18 ccsbBroad304_08635 pLX_304 0% 65.7% 54.9% V5 (many diffs) n/a
19 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 50.9% 42.7% V5 (many diffs) n/a
20 ccsbBroadEn_15273 pDONR223 50.9% 63.9% 54.7% None (many diffs) n/a
21 ccsbBroad304_15273 pLX_304 0% 63.9% 54.7% V5 (many diffs) n/a
22 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 27.9% 23% V5 (not translated due to frame shift) (many diffs) n/a
23 ccsbBroadEn_11235 pDONR223 100% 23.1% 18.9% None (many diffs) n/a
24 ccsbBroad304_11235 pLX_304 0% 23.1% 18.9% V5 (many diffs) n/a
25 TRCN0000481650 TTTATCAAAGGAATCCCCAATTTT pLX_317 100% 23.1% 18.9% V5 (many diffs) n/a
26 ccsbBroadEn_15729 pDONR223 0% 11.1% 9.7% None (many diffs) n/a
27 ccsbBroad304_15729 pLX_304 0% 11.1% 9.7% V5 (many diffs) n/a
28 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 11.1% 9.7% V5 (many diffs) n/a
29 ccsbBroadEn_11384 pDONR223 100% 10.9% 9.9% None (many diffs) n/a
30 ccsbBroad304_11384 pLX_304 0% 10.9% 9.9% V5 (many diffs) n/a
31 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 10.9% 9.9% V5 (many diffs) n/a
32 ccsbBroadEn_13746 pDONR223 100% 10.4% 9.4% None (many diffs) n/a
33 ccsbBroad304_13746 pLX_304 0% 10.4% 9.4% V5 (many diffs) n/a
34 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 10.4% 9.4% V5 (many diffs) n/a
Download CSV