Transcript: Human XM_024452544.1

PREDICTED: Homo sapiens killer cell immunoglobulin like receptor, two Ig domains and short cytoplasmic tail 1 (KIR2DS1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIR2DS1 (3806)
Length:
2278
CDS:
898..1653

Additional Resources:

NCBI RefSeq record:
XM_024452544.1
NBCI Gene record:
KIR2DS1 (3806)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243133 GGAGGTGTCATACGCATAATT pLKO_005 1635 CDS 100% 15.000 7.500 Y KIR3DS1 n/a
2 TRCN0000430647 CATCGTGATCATAGGTCTATA pLKO_005 1095 CDS 100% 13.200 6.600 Y KIR2DS1 n/a
3 TRCN0000435229 GAGGTGTCATACGCATAATTG pLKO_005 1636 CDS 100% 13.200 6.600 Y KIR2DS4 n/a
4 TRCN0000428282 GCCTCTCTCTTGCTTACAAAT pLKO_005 1942 3UTR 100% 13.200 6.600 Y KIR2DL1 n/a
5 TRCN0000057032 GTCACAGGAAACCCTTCAAAT pLKO.1 1396 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
6 TRCN0000421852 TCCTTTGCTTAGCCCACAATT pLKO_005 2001 3UTR 100% 13.200 6.600 Y KIR2DS5 n/a
7 TRCN0000446297 ACGACACTTTGCGCCTCATTG pLKO_005 938 CDS 100% 10.800 5.400 Y KIR2DL1 n/a
8 TRCN0000418745 AGGCATCAGTCTTCATCTTAG pLKO_005 1886 3UTR 100% 10.800 5.400 Y KIR2DS5 n/a
9 TRCN0000243132 CTATGACATGTACCATCTATC pLKO_005 1200 CDS 100% 10.800 5.400 Y KIR3DS1 n/a
10 TRCN0000057030 CCTATGACATGTACCATCTAT pLKO.1 1199 CDS 100% 5.625 2.813 Y KIR2DS2 n/a
11 TRCN0000056827 CCTCTGGACATCGTGATCATA pLKO.1 1087 CDS 100% 5.625 2.813 Y KIR2DL1 n/a
12 TRCN0000057031 CCTGCAATGTTGGTCAGATGT pLKO.1 876 5UTR 100% 4.950 2.475 Y KIR2DS2 n/a
13 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 1323 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
14 TRCN0000056930 CTCCTCTTCTTTCTCCTTCAT pLKO.1 1516 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
15 TRCN0000056992 CTTCTCCATCAGTCGCATGAA pLKO.1 990 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
16 TRCN0000056825 GCAATGTTGGTCAGATGTCAT pLKO.1 879 5UTR 100% 4.950 2.475 Y KIR2DL1 n/a
17 TRCN0000149432 GCAATGTTGGTCAGATGTCAT pLKO.1 879 5UTR 100% 4.950 2.475 Y KIR3DP1 n/a
18 TRCN0000056929 GCTTGTTTCTGTCACAGGAAA pLKO.1 1386 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
19 TRCN0000063691 TGCAGGGAACAGAACAGTGAA pLKO.1 1584 CDS 100% 4.950 2.475 Y KIR2DL3 n/a
20 TRCN0000061717 TCAGGAGGTGTCATACGCATA pLKO.1 1632 CDS 100% 4.050 2.025 Y KIR2DS3 n/a
21 TRCN0000056991 GCCTGGTGAAATCAGAAGAGA pLKO.1 848 5UTR 100% 3.000 1.500 Y KIR2DS1 n/a
22 TRCN0000056988 GTCATGTTTGAACACTTCCTT pLKO.1 895 5UTR 100% 3.000 1.500 Y KIR2DS1 n/a
23 TRCN0000056990 GATTCTGATGAACAAGACCAT pLKO.1 1612 CDS 100% 2.640 1.320 Y KIR2DS1 n/a
24 TRCN0000056758 CCTGCAATGTTGGTCAGATAT pLKO.1 876 5UTR 100% 13.200 6.600 Y KIR3DL1 n/a
25 TRCN0000063023 CCTCCTCTTCTTTCTCCTTTA pLKO.1 1515 CDS 100% 10.800 5.400 Y KIR3DL2 n/a
26 TRCN0000417192 TTGGGACCTCAGTGGTCAAAC pLKO_005 1481 CDS 100% 10.800 5.400 Y KIR2DS5 n/a
27 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 1381 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452544.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 81% 67.1% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 80.3% 65.7% V5 (not translated due to prior stop codon) (many diffs) n/a
3 ccsbBroadEn_14687 pDONR223 73.4% 79.7% 65.1% None (many diffs) n/a
4 ccsbBroad304_14687 pLX_304 0% 79.7% 65.1% V5 (not translated due to prior stop codon) (many diffs) n/a
5 ccsbBroadEn_13888 pDONR223 100% 78.8% 4% None (many diffs) n/a
6 ccsbBroad304_13888 pLX_304 0% 78.8% 4% V5 (not translated due to prior stop codon) (many diffs) n/a
7 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 78.8% 4% V5 (not translated due to prior stop codon) (many diffs) n/a
8 ccsbBroadEn_06487 pDONR223 100% 69.5% 65.9% None (many diffs) n/a
9 ccsbBroad304_06487 pLX_304 0% 69.5% 65.9% V5 (many diffs) n/a
10 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 69.5% 65.9% V5 (many diffs) n/a
11 ccsbBroadEn_13754 pDONR223 100% 69.5% 64.3% None (many diffs) n/a
12 ccsbBroad304_13754 pLX_304 0% 69.5% 64.3% V5 (many diffs) n/a
13 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 69.5% 64.3% V5 (many diffs) n/a
14 ccsbBroadEn_10936 pDONR223 100% 64.2% 62.1% None (many diffs) n/a
15 ccsbBroad304_10936 pLX_304 0% 64.2% 62.1% V5 (many diffs) n/a
16 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 64.2% 62.1% V5 (many diffs) n/a
17 ccsbBroadEn_13889 pDONR223 100% 53.2% 26.7% None (many diffs) n/a
18 ccsbBroadEn_00908 pDONR223 100% 53.1% 45.9% None (many diffs) n/a
19 ccsbBroad304_00908 pLX_304 0% 53.1% 45.9% V5 (many diffs) n/a
20 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 53.1% 45.9% V5 (many diffs) n/a
21 ccsbBroadEn_06489 pDONR223 100% 50.9% 46.6% None (many diffs) n/a
22 ccsbBroad304_06489 pLX_304 0% 50.9% 46.6% V5 (many diffs) n/a
23 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 50.9% 46.6% V5 (many diffs) n/a
24 ccsbBroadEn_00907 pDONR223 100% 49.5% 44.8% None (many diffs) n/a
25 ccsbBroad304_00907 pLX_304 0% 49.5% 44.8% V5 (many diffs) n/a
26 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 49.5% 44.8% V5 (many diffs) n/a
27 ccsbBroadEn_09418 pDONR223 100% 47.3% 41.4% None (many diffs) n/a
28 ccsbBroad304_09418 pLX_304 0% 47.3% 41.4% V5 (many diffs) n/a
Download CSV