Transcript: Human XR_001753717.2

PREDICTED: Homo sapiens zinc finger protein 701 (ZNF701), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF701 (55762)
Length:
3541
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001753717.2
NBCI Gene record:
ZNF701 (55762)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001753717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420180 TGAGTAGTACAGAGCGACATG pLKO_005 476 3UTR 100% 4.050 5.670 N ZNF701 n/a
2 TRCN0000423921 GCAGTTCATTGGCGATCTTAT pLKO_005 1977 3UTR 100% 13.200 9.240 N ZNF701 n/a
3 TRCN0000424893 CAAGGATTTCGGGTGTGATTC pLKO_005 1698 3UTR 100% 10.800 7.560 N ZNF701 n/a
4 TRCN0000020887 GTCATCACATTGGAGATACTT pLKO.1 353 3UTR 100% 5.625 3.938 N ZNF701 n/a
5 TRCN0000020885 CGGCAAGGACTTTCATCAGAA pLKO.1 861 3UTR 100% 4.950 3.465 N ZNF701 n/a
6 TRCN0000020884 CGGGAAGTACACACAAGAGAA pLKO.1 733 3UTR 100% 4.950 3.465 N ZNF701 n/a
7 TRCN0000020886 CCTGTTAGTTCACAAGGCAAT pLKO.1 969 3UTR 100% 4.050 2.835 N ZNF701 n/a
8 TRCN0000419166 AGACATTCAGTCACAATTCAG pLKO_005 947 3UTR 100% 4.950 2.970 N ZNF701 n/a
9 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 220 3UTR 100% 15.000 7.500 Y ZNF765 n/a
10 TRCN0000021906 CCCTGCTCAGAGGACTCTATA pLKO.1 195 3UTR 100% 13.200 6.600 Y ZNF765 n/a
11 TRCN0000012913 CGGATCATTGTCCCTTCTTAT pLKO.1 2893 3UTR 100% 13.200 6.600 Y ZNF137P n/a
12 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1100 3UTR 100% 5.625 2.813 Y ZNF702P n/a
13 TRCN0000021908 TCAGGGATGTGGCCATAGAAT pLKO.1 146 3UTR 100% 5.625 2.813 Y ZNF765 n/a
14 TRCN0000150044 CCTTGAAAGACATAGGAGAAT pLKO.1 1137 3UTR 100% 4.950 2.475 Y ZNF816 n/a
15 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 985 3UTR 100% 4.950 2.475 Y ZNF702P n/a
16 TRCN0000150214 GTAATGAATGTGGCAAGGTTT pLKO.1 1016 3UTR 100% 4.950 2.475 Y ZNF813 n/a
17 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 228 3UTR 100% 2.640 1.320 Y ZNF765 n/a
18 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1184 3UTR 100% 2.640 1.320 Y ZNF468 n/a
19 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1084 3UTR 100% 4.950 2.475 Y ZNF28 n/a
20 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 985 3UTR 100% 4.950 2.475 Y ZNF321P n/a
21 TRCN0000148611 CGTAGACTTCATACTGGAGAA pLKO.1 1402 3UTR 100% 4.050 2.025 Y ZNF761 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001753717.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08581 pDONR223 100% 39.2% None (many diffs) n/a
2 ccsbBroad304_08581 pLX_304 0% 39.2% V5 (many diffs) n/a
3 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 39.2% V5 (many diffs) n/a
4 ccsbBroadEn_15256 pDONR223 64.6% 25.3% None (many diffs) n/a
5 ccsbBroad304_15256 pLX_304 0% 25.3% V5 (many diffs) n/a
6 TRCN0000466083 GTTTGTTCTAAACATTGCGACATC pLX_317 35.1% 15.7% V5 (not translated due to frame shift) (many diffs) n/a
7 ccsbBroadEn_10493 pDONR223 100% 15.3% None (many diffs) n/a
8 ccsbBroad304_10493 pLX_304 0% 15.3% V5 (many diffs) n/a
9 TRCN0000473858 GACTCTAACGAATGTATACCTGAC pLX_317 78.5% 15.3% V5 (many diffs) n/a
10 ccsbBroadEn_05629 pDONR223 100% 12.1% None (many diffs) n/a
11 ccsbBroad304_05629 pLX_304 0% 12.1% V5 (many diffs) n/a
12 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 12.1% V5 (many diffs) n/a
13 ccsbBroadEn_12938 pDONR223 100% 6.7% None (many diffs) n/a
14 ccsbBroad304_12938 pLX_304 0% 6.7% V5 (many diffs) n/a
15 TRCN0000465769 GCGACGTTTCATCACCCAGACTTT pLX_317 100% 6.7% V5 (many diffs) n/a
16 ccsbBroadEn_14339 pDONR223 100% 4.8% None (many diffs) n/a
17 ccsbBroad304_14339 pLX_304 0% 4.8% V5 (not translated due to prior stop codon) (many diffs) n/a
18 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 4.8% V5 (not translated due to prior stop codon) (many diffs) n/a
19 ccsbBroadEn_13667 pDONR223 100% 2.6% None (many diffs) n/a
20 ccsbBroad304_13667 pLX_304 0% 2.6% V5 (many diffs) n/a
21 TRCN0000471939 ATACCCTTCTTATTCAGAGCAATT pLX_317 100% 2.6% V5 (many diffs) n/a
Download CSV