Transcript: Human NM_001159293.2

Homo sapiens zinc finger protein 737 (ZNF737), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
ZNF737 (100129842)
Length:
8352
CDS:
142..1752

Additional Resources:

NCBI RefSeq record:
NM_001159293.2
NBCI Gene record:
ZNF737 (100129842)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000344387 TATCCTTACTGCGCATAAGAT pLKO_005 1035 CDS 100% 5.625 3.938 N ZNF737 n/a
2 TRCN0000344450 GACACTGCACAGCGGAATTTA pLKO_005 205 CDS 100% 15.000 7.500 Y ZNF737 n/a
3 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 953 CDS 100% 13.200 6.600 Y ZNF98 n/a
4 TRCN0000344389 ACCTTACTGCACATAAGATAA pLKO_005 869 CDS 100% 13.200 6.600 Y ZNF737 n/a
5 TRCN0000236730 CCCTTACTACACATAAGATAA pLKO_005 1373 CDS 100% 13.200 6.600 Y ZNF98 n/a
6 TRCN0000344452 CCCTTACTAGACATAAGATAA pLKO_005 1958 3UTR 100% 13.200 6.600 Y ZNF737 n/a
7 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 980 CDS 100% 13.200 6.600 Y Zfp934 n/a
8 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 980 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
9 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 980 CDS 100% 13.200 6.600 Y EG668616 n/a
10 TRCN0000344449 GCGGAGAGAAACCCTACAAAT pLKO_005 1064 CDS 100% 13.200 6.600 Y ZNF737 n/a
11 TRCN0000165774 CCTCCTAAGTAGCTGGGATTA pLKO.1 5687 3UTR 100% 10.800 5.400 Y SNX29P1 n/a
12 TRCN0000107294 CCTCTAACCTTACTACACATA pLKO.1 947 CDS 100% 4.950 2.475 Y ZNF66 n/a
13 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 237 CDS 100% 4.950 2.475 Y ZNF493 n/a
14 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 5659 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159293.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08635 pDONR223 100% 80.5% 69.7% None (many diffs) n/a
2 ccsbBroad304_08635 pLX_304 0% 80.5% 69.7% V5 (many diffs) n/a
3 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 63.3% 55.2% V5 (many diffs) n/a
4 ccsbBroadEn_15167 pDONR223 53.6% 78% 33.5% None (many diffs) n/a
5 ccsbBroad304_15167 pLX_304 0% 78% 33.5% V5 (not translated due to prior stop codon) (many diffs) n/a
6 ccsbBroadEn_09655 pDONR223 100% 74.8% 66.4% None (many diffs) n/a
7 ccsbBroad304_09655 pLX_304 0% 74.8% 66.4% V5 (many diffs) n/a
8 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 74.8% 66.4% V5 (many diffs) n/a
9 ccsbBroadEn_15273 pDONR223 50.9% 74.7% 64.5% None (many diffs) n/a
10 ccsbBroad304_15273 pLX_304 0% 74.7% 64.5% V5 (many diffs) n/a
11 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 33.5% 28.5% V5 (not translated due to frame shift) (many diffs) n/a
12 ccsbBroadEn_09302 pDONR223 100% 72.4% 63.3% None (many diffs) n/a
13 ccsbBroad304_09302 pLX_304 0% 72.4% 63.3% V5 (many diffs) n/a
14 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 72.4% 63.3% V5 (many diffs) n/a
15 ccsbBroadEn_12296 pDONR223 100% 67.4% 56.9% None (many diffs) n/a
16 TRCN0000478211 CAAATCTCTGTTGACCAGACGGTG pLX_317 19.4% 67.4% 56.9% V5 (many diffs) n/a
17 ccsbBroadEn_07157 pDONR223 100% 57.4% 50.5% None (many diffs) n/a
18 ccsbBroad304_07157 pLX_304 0% 57.4% 50.5% V5 (many diffs) n/a
19 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 57.4% 50.5% V5 (many diffs) n/a
20 ccsbBroadEn_05180 pDONR223 100% 15.6% 12.8% None (many diffs) n/a
21 ccsbBroad304_05180 pLX_304 0% 15.6% 12.8% V5 (many diffs) n/a
22 TRCN0000466983 TATCGTATGCAGTGATGCCATGTC pLX_317 100% 15.6% 12.8% V5 (many diffs) n/a
23 ccsbBroadEn_15729 pDONR223 0% 13% 11.4% None (many diffs) n/a
24 ccsbBroad304_15729 pLX_304 0% 13% 11.4% V5 (many diffs) n/a
25 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 13% 11.4% V5 (many diffs) n/a
26 ccsbBroadEn_13746 pDONR223 100% 12.3% 10.8% None (many diffs) n/a
27 ccsbBroad304_13746 pLX_304 0% 12.3% 10.8% V5 (many diffs) n/a
28 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 12.3% 10.8% V5 (many diffs) n/a
Download CSV