Transcript: Human XR_002958675.1

PREDICTED: Homo sapiens apolipoprotein B mRNA editing enzyme catalytic subunit 3F (APOBEC3F), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
APOBEC3F (200316)
Length:
4301
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_002958675.1
NBCI Gene record:
APOBEC3F (200316)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

Data temporarily unavailable. Refresh page to try again.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_002958675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000052123 CGCGTGAAGATTATGGACGAT pLKO.1 2548 3UTR 100% 2.640 3.696 N APOBEC3F n/a
2 TRCN0000447203 AGCAAGCTGCAGGAGATTCTC pLKO_005 3060 3UTR 100% 4.950 3.465 N APOBEC3F n/a
3 TRCN0000412641 GACGATGAAGAATTTGCATAC pLKO_005 2563 3UTR 100% 6.000 3.600 N APOBEC3F n/a
4 TRCN0000052124 GTGGAGATCATGGGCTACAAA pLKO.1 2946 3UTR 100% 5.625 3.375 N APOBEC3F n/a
5 TRCN0000052127 CCATCCTTTCTCGTCGGAATA pLKO.1 2195 3UTR 100% 10.800 5.400 Y APOBEC3F n/a
6 TRCN0000140811 GCACGCTAAAGGAGATTCTCA pLKO.1 2666 3UTR 100% 3.000 1.500 Y APOBEC3B n/a
7 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3644 3UTR 100% 5.625 2.813 Y KLHL30 n/a
8 TRCN0000142875 CCTTGGTACAAATTCGATGAA pLKO.1 2626 3UTR 100% 4.950 2.475 Y APOBEC3B n/a
9 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3644 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_002958675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09805 pDONR223 100% 21.5% None (many diffs) n/a
2 ccsbBroad304_09805 pLX_304 0% 21.5% V5 (many diffs) n/a
3 TRCN0000468435 GTGTACATTTACATTTGTTTCTTA pLX_317 35% 21.5% V5 (many diffs) n/a
4 ccsbBroadEn_09588 pDONR223 100% 19.1% None (many diffs) n/a
5 ccsbBroad304_09588 pLX_304 0% 19.1% V5 (many diffs) n/a
6 TRCN0000466607 ACTCGATAAAACTAGGGCTATTAC pLX_317 33.8% 19.1% V5 (many diffs) n/a
7 ccsbBroadEn_11391 pDONR223 100% 14.4% None (many diffs) n/a
8 ccsbBroad304_11391 pLX_304 0% 14.4% V5 (many diffs) n/a
9 TRCN0000473426 GTTAGAAGAAACTTATTTCCATTA pLX_317 28.8% 14.4% V5 (many diffs) n/a
10 ccsbBroadEn_08087 pDONR223 100% 11.7% None (many diffs) n/a
11 ccsbBroad304_08087 pLX_304 0% 11.7% V5 (many diffs) n/a
12 TRCN0000480993 GATCGGGACTTACTATGTTTATTC pLX_317 71.3% 11.7% V5 (many diffs) n/a
13 ccsbBroadEn_13781 pDONR223 100% 5.6% None (many diffs) n/a
14 ccsbBroad304_13781 pLX_304 0% 5.6% V5 (many diffs) n/a
15 TRCN0000469746 TCCCTGCGCCGTCCGGGTTTTCGA pLX_317 100% 5.6% V5 (many diffs) n/a
16 ccsbBroadEn_10261 pDONR223 100% 1.4% None (many diffs) n/a
17 ccsbBroad304_10261 pLX_304 0% 1.4% V5 (many diffs) n/a
18 TRCN0000492083 TTATAGGCCCAGAGCACTACCAAC pLX_317 100% 1.4% V5 (many diffs) n/a
Download CSV