Transcript: Human NM_001348689.2

Homo sapiens zinc finger protein 726 (ZNF726), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF726 (730087)
Length:
1794
CDS:
110..343

Additional Resources:

NCBI RefSeq record:
NM_001348689.2
NBCI Gene record:
ZNF726 (730087)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001348689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 235 CDS 100% 4.950 2.475 Y ZNF675 n/a
2 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 205 CDS 100% 4.950 2.475 Y ZNF493 n/a
3 TRCN0000256748 GGCAGGAGAATTGCTTGAATC pLKO_005 1452 3UTR 100% 10.800 5.400 Y SMIM11A n/a
4 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 923 3UTR 100% 5.625 2.813 Y KLHL30 n/a
5 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 923 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001348689.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13746 pDONR223 100% 99.5% 100% None 168G>T n/a
2 ccsbBroad304_13746 pLX_304 0% 99.5% 100% V5 168G>T n/a
3 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 99.5% 100% V5 168G>T n/a
4 ccsbBroadEn_15729 pDONR223 0% 85.1% 76.5% None (many diffs) n/a
5 ccsbBroad304_15729 pLX_304 0% 85.1% 76.5% V5 (many diffs) n/a
6 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 85.1% 76.5% V5 (many diffs) n/a
7 ccsbBroadEn_11384 pDONR223 100% 79.4% 75.8% None (many diffs) n/a
8 ccsbBroad304_11384 pLX_304 0% 79.4% 75.8% V5 (many diffs) n/a
9 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 79.4% 75.8% V5 (many diffs) n/a
10 ccsbBroadEn_11549 pDONR223 100% 48.9% 41.9% None (many diffs) n/a
11 ccsbBroad304_11549 pLX_304 94.6% 48.9% 41.9% V5 (many diffs) n/a
12 TRCN0000468281 AACATTAGGAAAGAACCCCCACCC pLX_317 100% 48.9% 41.9% V5 (many diffs) n/a
13 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 25.3% 22.4% V5 (not translated due to frame shift) (many diffs) n/a
14 ccsbBroadEn_15273 pDONR223 50.9% 12.3% 10.8% None (many diffs) n/a
15 ccsbBroad304_15273 pLX_304 0% 12.3% 10.8% V5 (many diffs) n/a
16 ccsbBroadEn_15167 pDONR223 53.6% 11.8% 21.7% None (many diffs) n/a
17 ccsbBroad304_15167 pLX_304 0% 11.8% 21.7% V5 (not translated due to prior stop codon) (many diffs) n/a
18 ccsbBroadEn_15279 pDONR223 63.5% 16.3% 25.1% None (many diffs) n/a
19 ccsbBroadEn_10024 pDONR223 100% 12.7% 11.6% None (many diffs) n/a
20 ccsbBroad304_10024 pLX_304 0% 12.7% 11.6% V5 (many diffs) n/a
21 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 12.7% 11.6% V5 (many diffs) n/a
22 ccsbBroadEn_15278 pDONR223 59.5% 11.4% 10.5% None (many diffs) n/a
23 ccsbBroad304_15278 pLX_304 0% 11.4% 10.5% V5 (many diffs) n/a
24 ccsbBroadEn_09784 pDONR223 100% 11.9% 10% None (many diffs) n/a
25 ccsbBroad304_09784 pLX_304 0% 11.9% 10% V5 (many diffs) n/a
26 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 11.9% 10% V5 (many diffs) n/a
27 ccsbBroadEn_02188 pDONR223 100% 10.9% 10.4% None (many diffs) n/a
28 ccsbBroad304_02188 pLX_304 0% 10.9% 10.4% V5 (many diffs) n/a
29 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 10.9% 10.4% V5 (many diffs) n/a
30 ccsbBroadEn_07157 pDONR223 100% 8.5% 7.6% None (many diffs) n/a
31 ccsbBroad304_07157 pLX_304 0% 8.5% 7.6% V5 (many diffs) n/a
32 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 8.5% 7.6% V5 (many diffs) n/a
33 ccsbBroadEn_11550 pDONR223 100% 7.2% 6.1% None (many diffs) n/a
34 ccsbBroad304_11550 pLX_304 0% 7.2% 6.1% V5 (many diffs) n/a
35 ccsbBroadEn_13028 pDONR223 100% 7.1% 6.2% None (many diffs) n/a
36 ccsbBroad304_13028 pLX_304 0% 7.1% 6.2% V5 (many diffs) n/a
37 TRCN0000468257 GTACACCAGACCACTACATGCGAC pLX_317 25.6% 7.1% 6.2% V5 (many diffs) n/a
38 ccsbBroadEn_09655 pDONR223 100% 6.9% 6% None (many diffs) n/a
39 ccsbBroad304_09655 pLX_304 0% 6.9% 6% V5 (many diffs) n/a
40 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 6.9% 6% V5 (many diffs) n/a
Download CSV