Transcript: Human NM_006001.3

Homo sapiens tubulin alpha 3c (TUBA3C), mRNA.

Source:
NCBI, updated 2019-09-26
Taxon:
Homo sapiens (human)
Gene:
TUBA3C (7278)
Length:
1521
CDS:
78..1430

Additional Resources:

NCBI RefSeq record:
NM_006001.3
NBCI Gene record:
TUBA3C (7278)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265777 AGTGCGCACAGGAACCTATAG pLKO_005 308 CDS 100% 10.800 7.560 N TUBA3C n/a
2 TRCN0000062484 CCCGGTCATCTCAGCCGAGAA pLKO.1 896 CDS 100% 0.000 0.000 N TUBA3C n/a
3 TRCN0000265748 GAAGGAAGATGCGGCCAATAA pLKO_005 362 CDS 100% 13.200 7.920 N TUBA3C n/a
4 TRCN0000062483 CCAAGCTAGAATTTGCCATTT pLKO.1 571 CDS 100% 10.800 6.480 N TUBA3C n/a
5 TRCN0000062485 GCTCTGGAGAAGGATTATGAA pLKO.1 1356 CDS 100% 5.625 3.375 N TUBA3C n/a
6 TRCN0000062487 CGCACCATCCAGTTTGTAGAT pLKO.1 1092 CDS 100% 4.950 2.970 N TUBA3C n/a
7 TRCN0000265763 GGATGTGGTCCCGAAAGATGT pLKO_005 1040 CDS 100% 4.950 2.970 N TUBA3C n/a
8 TRCN0000265791 ATGAAGCCATCTATGACATAT pLKO_005 694 CDS 100% 13.200 6.600 Y TUBA3C n/a
9 TRCN0000265792 ATAAGTTCGATCTCATGTATG pLKO_005 1255 CDS 100% 10.800 5.400 Y TUBA3C n/a
10 TRCN0000117168 CTGGATTTAAGGTGGGCATTA pLKO.1 1123 CDS 100% 10.800 5.400 Y TUBA3E n/a
11 TRCN0000117171 CATAAGTTCGATCTCATGTAT pLKO.1 1254 CDS 100% 5.625 2.813 Y TUBA3E n/a
12 TRCN0000062486 CGACTCCTTCAACACGTTCTT pLKO.1 215 CDS 100% 4.950 2.475 Y TUBA3C n/a
13 TRCN0000116575 GCCTTCATGGTCGACAATGAA pLKO.1 678 CDS 100% 0.563 0.281 Y TUBA3D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006001.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09386 pDONR223 100% 96.5% 99.7% None (many diffs) n/a
2 ccsbBroad304_09386 pLX_304 0% 96.5% 99.7% V5 (many diffs) n/a
3 TRCN0000465924 GTCATGGAGAAAGTCGGTGACCGG pLX_317 28.5% 96.5% 99.7% V5 (many diffs) n/a
4 ccsbBroadEn_09375 pDONR223 100% 96.2% 98.8% None (many diffs) n/a
5 ccsbBroad304_09375 pLX_304 0% 96.2% 98.8% V5 (many diffs) n/a
6 TRCN0000469142 GAGGCCACAGGCCATAAACTAATT pLX_317 29% 96.2% 98.8% V5 (many diffs) n/a
7 ccsbBroadEn_02413 pDONR223 100% 84.8% 97.1% None (many diffs) n/a
8 ccsbBroad304_02413 pLX_304 0% 84.8% 97.1% V5 (many diffs) n/a
9 TRCN0000466437 GGCACCAGGAAACTAGGGGTGTGT pLX_317 31.7% 84.8% 97.1% V5 (many diffs) n/a
10 ccsbBroadEn_15707 pDONR223 0% 84.7% 97.1% None (many diffs) n/a
11 ccsbBroad304_15707 pLX_304 0% 84.7% 97.1% V5 (many diffs) n/a
12 TRCN0000467476 CACCGTCGAGGCCGCTGTATAAGA pLX_317 31.7% 84.7% 97.1% V5 (many diffs) n/a
13 ccsbBroadEn_15706 pDONR223 0% 84.7% 97.1% None (many diffs) n/a
14 ccsbBroad304_15706 pLX_304 0% 84.7% 97.1% V5 (many diffs) n/a
15 TRCN0000472335 TTCTGAAATAAGACACGCCGGGCA pLX_317 37.9% 84.7% 97.1% V5 (many diffs) n/a
16 ccsbBroadEn_01831 pDONR223 100% 84.2% 97.5% None (many diffs) n/a
17 ccsbBroad304_01831 pLX_304 0% 84.2% 97.5% V5 (many diffs) n/a
18 TRCN0000466264 GACTTCAAATAAATAGCTTCACTC pLX_317 23.8% 84.2% 97.5% V5 (many diffs) n/a
19 ccsbBroadEn_07108 pDONR223 100% 84.1% 94.2% None (many diffs) n/a
20 ccsbBroad304_07108 pLX_304 0% 84.1% 94.2% V5 (many diffs) n/a
21 TRCN0000467865 AGTTCGTGAAACATACGCCGGCAG pLX_317 34.6% 84.1% 94.2% V5 (many diffs) n/a
22 ccsbBroadEn_16042 pDONR223 0% 83.8% 96.2% None (many diffs) n/a
23 ccsbBroad304_16042 pLX_304 0% 83.8% 96.2% V5 (many diffs) n/a
24 ccsbBroadEn_09222 pDONR223 100% 83.8% 96.2% None (many diffs) n/a
25 ccsbBroad304_09222 pLX_304 0% 83.8% 96.2% V5 (many diffs) n/a
26 ccsbBroadEn_16043 pDONR223 0% 83.7% 96.2% None (many diffs) n/a
27 ccsbBroad304_16043 pLX_304 0% 83.7% 96.2% V5 (many diffs) n/a
28 TRCN0000465274 AATTCTCGGGCCTTAAGCACTAAC pLX_317 23.4% 83.7% 96.2% V5 (many diffs) n/a
29 ccsbBroadEn_15708 pDONR223 0% 63.4% 72.5% None (many diffs) n/a
30 ccsbBroadEn_13025 pDONR223 100% 27.6% 20.1% None (many diffs) n/a
31 ccsbBroad304_13025 pLX_304 0% 27.6% 20.1% V5 (many diffs) n/a
32 TRCN0000479840 AAGCTCACCCGGTCACACACAATA pLX_317 79.2% 27.6% 20.1% V5 (many diffs) n/a
Download CSV