Transcript: Human NM_006737.4

Homo sapiens killer cell immunoglobulin like receptor, three Ig domains and long cytoplasmic tail 2 (KIR3DL2), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
KIR3DL2 (3812)
Length:
1877
CDS:
34..1401

Additional Resources:

NCBI RefSeq record:
NM_006737.4
NBCI Gene record:
KIR3DL2 (3812)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_006737.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000063025 GCAGGAACCTACAGATGTTAT pLKO.1 601 CDS 100% 13.200 7.920 N KIR3DL2 n/a
2 TRCN0000063027 GTCATGTTTGAGCACTTCTTT pLKO.1 475 CDS 100% 5.625 3.375 N KIR3DL2 n/a
3 TRCN0000063026 GTGGCTCTTCAGTGTCACTAT pLKO.1 166 CDS 100% 4.950 2.970 N KIR3DL2 n/a
4 TRCN0000063024 CCTAACAGATACCAGCGTGTA pLKO.1 1296 CDS 100% 4.050 2.430 N KIR3DL2 n/a
5 TRCN0000428282 GCCTCTCTCTTGCTTACAAAT pLKO_005 1522 3UTR 100% 13.200 6.600 Y KIR2DL1 n/a
6 TRCN0000056760 CCACAGAACCAAGCTCCAAAT pLKO.1 1010 CDS 100% 10.800 5.400 Y KIR3DL1 n/a
7 TRCN0000063023 CCTCCTCTTCTTTCTCCTTTA pLKO.1 1095 CDS 100% 10.800 5.400 Y KIR3DL2 n/a
8 TRCN0000056928 GCCCAAGGTCAACAGAACATT pLKO.1 840 CDS 100% 5.625 2.813 Y KIR2DS5 n/a
9 TRCN0000057031 CCTGCAATGTTGGTCAGATGT pLKO.1 456 CDS 100% 4.950 2.475 Y KIR2DS2 n/a
10 TRCN0000056989 CTACAGATGCTTCGGCTCTTT pLKO.1 903 CDS 100% 4.950 2.475 Y KIR2DS1 n/a
11 TRCN0000056825 GCAATGTTGGTCAGATGTCAT pLKO.1 459 CDS 100% 4.950 2.475 Y KIR2DL1 n/a
12 TRCN0000149432 GCAATGTTGGTCAGATGTCAT pLKO.1 459 CDS 100% 4.950 2.475 Y KIR3DP1 n/a
13 TRCN0000056929 GCTTGTTTCTGTCACAGGAAA pLKO.1 966 CDS 100% 4.950 2.475 Y KIR2DS5 n/a
14 TRCN0000056931 CAGGTCTATATGAGAAACCTT pLKO.1 686 CDS 100% 3.000 1.500 Y KIR2DS5 n/a
15 TRCN0000056758 CCTGCAATGTTGGTCAGATAT pLKO.1 456 CDS 100% 13.200 6.600 Y KIR3DL1 n/a
16 TRCN0000057032 GTCACAGGAAACCCTTCAAAT pLKO.1 976 CDS 100% 13.200 6.600 Y KIR2DS2 n/a
17 TRCN0000421852 TCCTTTGCTTAGCCCACAATT pLKO_005 1581 3UTR 100% 13.200 6.600 Y KIR2DS5 n/a
18 TRCN0000146939 CCTATGACATCTACCATCTAT pLKO.1 779 CDS 100% 5.625 2.813 Y KIR3DP1 n/a
19 TRCN0000061458 CCACTGCTTGTTTCTGTCATA pLKO.1 961 CDS 100% 4.950 2.475 Y KIR2DL2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_006737.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00907 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_00907 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000492063 GACTAACCGAGACGTTGGGATCTG pLX_317 9.5% 100% 100% V5 n/a
4 ccsbBroadEn_06489 pDONR223 100% 90.7% 83.5% None (many diffs) n/a
5 ccsbBroad304_06489 pLX_304 0% 90.7% 83.5% V5 (many diffs) n/a
6 TRCN0000469534 TAGGTTCAGTACAATACTGACCCA pLX_317 32.5% 90.7% 83.5% V5 (many diffs) n/a
7 ccsbBroadEn_09418 pDONR223 100% 79% 70.1% None (many diffs) n/a
8 ccsbBroad304_09418 pLX_304 0% 79% 70.1% V5 (many diffs) n/a
9 ccsbBroadEn_00908 pDONR223 100% 77.4% 68.7% None (many diffs) n/a
10 ccsbBroad304_00908 pLX_304 0% 77.4% 68.7% V5 (many diffs) n/a
11 TRCN0000472352 TATTAACAAGCCGTGATAGGACCA pLX_317 26.7% 77.4% 68.7% V5 (many diffs) n/a
12 ccsbBroadEn_13889 pDONR223 100% 77.4% 52.7% None (many diffs) n/a
13 ccsbBroadEn_06487 pDONR223 100% 68.8% 63.2% None (many diffs) n/a
14 ccsbBroad304_06487 pLX_304 0% 68.8% 63.2% V5 (many diffs) n/a
15 TRCN0000474884 GAAATACACGTCGTTCCGCTTCCC pLX_317 47.5% 68.8% 63.2% V5 (many diffs) n/a
16 ccsbBroadEn_13754 pDONR223 100% 68.2% 62.8% None (many diffs) n/a
17 ccsbBroad304_13754 pLX_304 0% 68.2% 62.8% V5 (many diffs) n/a
18 TRCN0000471889 GAGCTCTCCAGTGTGATCTGCACG pLX_317 26.6% 68.2% 62.8% V5 (many diffs) n/a
19 ccsbBroadEn_10936 pDONR223 100% 66.6% 60.4% None (many diffs) n/a
20 ccsbBroad304_10936 pLX_304 0% 66.6% 60.4% V5 (many diffs) n/a
21 TRCN0000475707 TATTACGCGGTACACTTGCGGTTC pLX_317 26.1% 66.6% 60.4% V5 (many diffs) n/a
22 ccsbBroadEn_06488 pDONR223 100% 63.8% 53.4% None (many diffs) n/a
23 ccsbBroad304_06488 pLX_304 0% 63.8% 53.4% V5 (many diffs) n/a
24 TRCN0000480702 ACTCACGGACTGCAGTACACGCGC pLX_317 26.5% 63.8% 53.4% V5 (many diffs) n/a
25 ccsbBroadEn_13888 pDONR223 100% 60.8% 3.4% None (many diffs) n/a
26 ccsbBroad304_13888 pLX_304 0% 60.8% 3.4% V5 (not translated due to prior stop codon) (many diffs) n/a
27 TRCN0000479468 TCAGTAGCAAGTTATTCAATCTAG pLX_317 32.5% 60.8% 3.4% V5 (not translated due to prior stop codon) (many diffs) n/a
28 TRCN0000479236 CTGTCAGATCCGTACCTGTCATTG pLX_317 52% 60.7% 48.3% V5 (not translated due to prior stop codon) (many diffs) n/a
29 TRCN0000474077 AGACCGCGTCCAACGTCATACTTT pLX_317 34.7% 60.6% 48.1% V5 (not translated due to prior stop codon) (many diffs) n/a
30 ccsbBroadEn_14687 pDONR223 73.4% 60.5% 48.3% None (many diffs) n/a
31 ccsbBroad304_14687 pLX_304 0% 60.5% 48.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV