Transcript: Human NM_001031850.4

Homo sapiens pregnancy specific beta-1-glycoprotein 6 (PSG6), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
PSG6 (5675)
Length:
1703
CDS:
103..1377

Additional Resources:

NCBI RefSeq record:
NM_001031850.4
NBCI Gene record:
PSG6 (5675)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001031850.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000373333 CCACCACTGCCCAAGTAATAA pLKO_005 194 CDS 100% 15.000 10.500 N PSG6 n/a
2 TRCN0000179362 GTCGGAACTACACCTACATTT pLKO.1 896 CDS 100% 13.200 9.240 N PSG6 n/a
3 TRCN0000373331 TACACGGTCAAATTATATATG pLKO_005 353 CDS 100% 13.200 9.240 N PSG6 n/a
4 TRCN0000373334 GTGGTTGCTGAATGGTCAGAA pLKO_005 636 CDS 100% 4.950 3.465 N PSG6 n/a
5 TRCN0000373332 GTAACTGGATATTTCACTGTC pLKO_005 499 CDS 100% 4.050 2.835 N PSG6 n/a
6 TRCN0000179759 GCCTTACATCACCATCAACAA pLKO.1 822 CDS 100% 4.950 2.970 N PSG6 n/a
7 TRCN0000271508 ACCTACATTTGGTGGCTAAAT pLKO_005 907 CDS 100% 13.200 6.600 Y PSG5 n/a
8 TRCN0000150062 CCTACACCTTACACATCATAA pLKO.1 455 CDS 100% 13.200 6.600 Y PSG4 n/a
9 TRCN0000179922 CGGACCTCTACCATTACATTA pLKO.1 320 CDS 100% 13.200 6.600 Y PSG6 n/a
10 TRCN0000271462 CTACACCTTACACATCATAAA pLKO_005 456 CDS 100% 13.200 6.600 Y PSG5 n/a
11 TRCN0000271507 CTACCCAGTGTCACGAGAAAT pLKO_005 988 CDS 100% 13.200 6.600 Y PSG5 n/a
12 TRCN0000271460 TTACCCTTCATTCACCTATTA pLKO_005 1110 CDS 100% 13.200 6.600 Y PSG5 n/a
13 TRCN0000179823 CACCTACATTTGGTGGCTAAA pLKO.1 906 CDS 100% 10.800 5.400 Y PSG8 n/a
14 TRCN0000158405 CCCAGTGTCACGAGAAATGAA pLKO.1 991 CDS 100% 5.625 2.813 Y PSG3 n/a
15 TRCN0000183406 CTTCAGCAATTGGTAAAGTAT pLKO.1 1564 3UTR 100% 5.625 2.813 Y PSG9 n/a
16 TRCN0000147665 GTGCTGATTCTTGGAATGTTT pLKO.1 1516 3UTR 100% 5.625 2.813 Y PSG2 n/a
17 TRCN0000149848 CAGGACCCTATGAATGTGAAA pLKO.1 734 CDS 100% 4.950 2.475 Y PSG2 n/a
18 TRCN0000153859 CAGGACCCTATGAATGTGAAA pLKO.1 734 CDS 100% 4.950 2.475 Y PSG7 n/a
19 TRCN0000162034 CAGGACCCTATGAATGTGAAA pLKO.1 734 CDS 100% 4.950 2.475 Y PSG1 n/a
20 TRCN0000148821 CCAGAATCTTACTGGCTACAT pLKO.1 279 CDS 100% 4.950 2.475 Y PSG2 n/a
21 TRCN0000153704 CCAGAATCTTACTGGCTACAT pLKO.1 279 CDS 100% 4.950 2.475 Y PSG7 n/a
22 TRCN0000156722 GCAGGACCCTATGAATGTGAA pLKO.1 733 CDS 100% 4.950 2.475 Y PSG3 n/a
23 TRCN0000156672 GTCACCCTGAATGTCCTCTAT pLKO.1 1069 CDS 100% 4.950 2.475 Y PSG5 n/a
24 TRCN0000183713 GTTCTTCTACTTGTCCACAAT pLKO.1 253 CDS 100% 4.950 2.475 Y PSG8 n/a
25 TRCN0000156409 CCCAGAATCTTACTGGCTACA pLKO.1 278 CDS 100% 4.050 2.025 Y PSG7 n/a
26 TRCN0000146886 CAAGGAAATCTCCAAATCCAT pLKO.1 1305 CDS 100% 3.000 1.500 Y PSG6 n/a
27 TRCN0000156684 GCTTGCTCTGTTCGTAACTCA pLKO.1 1276 CDS 100% 3.000 1.500 Y PSG3 n/a
28 TRCN0000148542 CGAGAAATGAAACAGGACCTT pLKO.1 1001 CDS 100% 2.640 1.320 Y PSG4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001031850.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01306 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01306 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000471433 CTGGAATGCCAAGAGGTCTTTGTC pLX_317 36.8% 100% 100% V5 n/a
4 ccsbBroadEn_06792 pDONR223 100% 93.6% 87.7% None (many diffs) n/a
5 ccsbBroad304_06792 pLX_304 0% 93.6% 87.7% V5 (many diffs) n/a
6 TRCN0000474743 AAGGCTCGCTCCACTACACCTGTC pLX_317 36.9% 93.6% 87.7% V5 (many diffs) n/a
7 ccsbBroadEn_06790 pDONR223 100% 92.4% 86.8% None (many diffs) n/a
8 ccsbBroad304_06790 pLX_304 0% 92.4% 86.8% V5 (many diffs) n/a
9 TRCN0000479480 CATGACTATTACGCGTCAGTGGAT pLX_317 14.3% 92.4% 86.8% V5 (many diffs) n/a
10 ccsbBroadEn_05670 pDONR223 100% 92% 85.8% None (many diffs) n/a
11 ccsbBroad304_05670 pLX_304 0% 92% 85.8% V5 (many diffs) n/a
12 TRCN0000480321 TTAGTTTTGGATGACTTAGATTGA pLX_317 31.4% 92% 85.8% V5 (many diffs) n/a
13 ccsbBroadEn_01305 pDONR223 100% 92% 85.5% None (many diffs) n/a
14 ccsbBroad304_01305 pLX_304 0% 92% 85.5% V5 (many diffs) n/a
15 TRCN0000466978 TTACTTGGCCAGTTCCACACTACA pLX_317 16.9% 92% 85.5% V5 (many diffs) n/a
16 ccsbBroadEn_11063 pDONR223 100% 91% 85.5% None (many diffs) n/a
17 ccsbBroad304_11063 pLX_304 0% 91% 85.5% V5 (many diffs) n/a
18 TRCN0000468204 TGCGGGCTCGACCCTGTATGAACC pLX_317 30.1% 91% 85.5% V5 (many diffs) n/a
19 ccsbBroadEn_06791 pDONR223 100% 71.4% 65.2% None (many diffs) n/a
20 ccsbBroad304_06791 pLX_304 0% 71.4% 65.2% V5 (many diffs) n/a
21 TRCN0000491658 GAGACGTGCGACATTCGGCGTTTC pLX_317 40.1% 71.4% 65.2% V5 (many diffs) n/a
22 ccsbBroadEn_13930 pDONR223 100% 70.4% 63.6% None (many diffs) n/a
23 ccsbBroad304_13930 pLX_304 0% 70.4% 63.6% V5 (not translated due to frame shift) (many diffs) n/a
24 TRCN0000475489 TTTAGGTATAAGCGGCATATCGAG pLX_317 31% 70.4% 63.6% V5 (not translated due to frame shift) (many diffs) n/a
25 ccsbBroadEn_06793 pDONR223 100% 44.5% 38% None (many diffs) n/a
26 ccsbBroad304_06793 pLX_304 0% 44.5% 38% V5 (many diffs) n/a
27 TRCN0000475187 CAACATGAGCTAGTACCTTGAGAG pLX_317 68.6% 44.5% 38% V5 (many diffs) n/a
Download CSV