Transcript: Human XM_011528259.3

PREDICTED: Homo sapiens zinc finger protein 43 (ZNF43), transcript variant X12, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF43 (7594)
Length:
5728
CDS:
668..3079

Additional Resources:

NCBI RefSeq record:
XM_011528259.3
NBCI Gene record:
ZNF43 (7594)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011528259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000218423 ATTAATGCTCGTACCTTATTG pLKO_005 3215 3UTR 100% 13.200 18.480 N ZNF43 n/a
2 TRCN0000234363 CCACATCTAGCTCAACATAAA pLKO_005 1208 CDS 100% 13.200 9.240 N ZNF43 n/a
3 TRCN0000147152 CTGAAGATGTGACAGTGATTT pLKO.1 3024 CDS 100% 13.200 9.240 N ZNF43 n/a
4 TRCN0000234365 CTGAAGATGTGACAGTGATTT pLKO_005 3024 CDS 100% 13.200 9.240 N ZNF43 n/a
5 TRCN0000234364 TGCCCTTCAATCATCACTAAA pLKO_005 1286 CDS 100% 13.200 9.240 N ZNF43 n/a
6 TRCN0000234362 GCCTATGAGGAGACATGAAAT pLKO_005 841 CDS 100% 13.200 7.920 N ZNF43 n/a
7 TRCN0000147126 CCCAGTTATGTGTTCTCATTT pLKO.1 874 CDS 100% 13.200 6.600 Y ZNF43 n/a
8 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 1911 CDS 100% 13.200 6.600 Y Zfp934 n/a
9 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 1911 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
10 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 1911 CDS 100% 13.200 6.600 Y EG668616 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 25 5UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 3142 3UTR 100% 5.625 2.813 Y ZNF254 n/a
13 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 2382 CDS 100% 4.950 2.475 Y ZNF714 n/a
14 TRCN0000016587 CCTGGGTATTGCTGTCTCTAA pLKO.1 775 CDS 100% 4.950 2.475 Y ZNF675 n/a
15 TRCN0000168774 GAGATGGAGTTTCACCATGTT pLKO.1 5389 3UTR 100% 4.950 2.475 Y LOC400464 n/a
16 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 745 CDS 100% 4.950 2.475 Y ZNF493 n/a
17 TRCN0000107758 TGTCTCTAAGCCAGACCTGAT pLKO.1 787 CDS 100% 4.050 2.025 Y ZNF273 n/a
18 TRCN0000018036 CCCAGTTATGTGTTCTCATAT pLKO.1 874 CDS 100% 13.200 6.600 Y ZNF257 n/a
19 TRCN0000107291 CCCTTTCTACACATAAGATAA pLKO.1 2724 CDS 100% 13.200 6.600 Y ZNF66 n/a
20 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 4309 3UTR 100% 13.200 6.600 Y IQCC n/a
21 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 25 5UTR 100% 10.800 5.400 Y CD3EAP n/a
22 TRCN0000179120 CAACATGGTGAAACCCTGTTT pLKO.1 4316 3UTR 100% 4.950 2.475 Y LOC339059 n/a
23 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1580 CDS 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011528259.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07157 pDONR223 100% 99.2% 99.1% None 0_1insATGGGACCATTAACATTT;670T>C n/a
2 ccsbBroad304_07157 pLX_304 0% 99.2% 99.1% V5 0_1insATGGGACCATTAACATTT;670T>C n/a
3 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 99.2% 99.1% V5 0_1insATGGGACCATTAACATTT;670T>C n/a
4 ccsbBroadEn_02188 pDONR223 100% 67.4% 57.4% None (many diffs) n/a
5 ccsbBroad304_02188 pLX_304 0% 67.4% 57.4% V5 (many diffs) n/a
6 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 67.4% 57.4% V5 (many diffs) n/a
7 ccsbBroadEn_15278 pDONR223 59.5% 62.3% 52.7% None (many diffs) n/a
8 ccsbBroad304_15278 pLX_304 0% 62.3% 52.7% V5 (many diffs) n/a
9 ccsbBroadEn_09655 pDONR223 100% 56.4% 48.6% None (many diffs) n/a
10 ccsbBroad304_09655 pLX_304 0% 56.4% 48.6% V5 (many diffs) n/a
11 TRCN0000468487 GAACACCAGATCGGTGGCCCTCAA pLX_317 20.1% 56.4% 48.6% V5 (many diffs) n/a
12 ccsbBroadEn_11232 pDONR223 100% 55.8% 48% None (many diffs) n/a
13 ccsbBroad304_11232 pLX_304 0% 55.8% 48% V5 (many diffs) n/a
14 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 55.8% 48% V5 (many diffs) n/a
15 ccsbBroadEn_09774 pDONR223 100% 55.8% 46.8% None (many diffs) n/a
16 ccsbBroad304_09774 pLX_304 0% 55.8% 46.8% V5 (many diffs) n/a
17 TRCN0000472815 CCTGACTCCCTTTAAGTGTTCGTG pLX_317 27.4% 55.8% 46.8% V5 (many diffs) n/a
18 ccsbBroadEn_09784 pDONR223 100% 55.8% 46.9% None (many diffs) n/a
19 ccsbBroad304_09784 pLX_304 0% 55.8% 46.9% V5 (many diffs) n/a
20 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 55.8% 46.9% V5 (many diffs) n/a
21 ccsbBroadEn_10024 pDONR223 100% 54.9% 45.9% None (many diffs) n/a
22 ccsbBroad304_10024 pLX_304 0% 54.9% 45.9% V5 (many diffs) n/a
23 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 54.9% 45.9% V5 (many diffs) n/a
24 ccsbBroadEn_15167 pDONR223 53.6% 54.2% 20.7% None (many diffs) n/a
25 ccsbBroad304_15167 pLX_304 0% 54.2% 20.7% V5 (not translated due to prior stop codon) (many diffs) n/a
26 ccsbBroadEn_08635 pDONR223 100% 51.4% 43% None (many diffs) n/a
27 ccsbBroad304_08635 pLX_304 0% 51.4% 43% V5 (many diffs) n/a
28 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 40.7% 33% V5 (many diffs) n/a
29 ccsbBroadEn_15273 pDONR223 50.9% 51.2% 42.4% None (many diffs) n/a
30 ccsbBroad304_15273 pLX_304 0% 51.2% 42.4% V5 (many diffs) n/a
31 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 22.4% 18.1% V5 (not translated due to frame shift) (many diffs) n/a
32 ccsbBroadEn_15729 pDONR223 0% 8.4% 7.2% None (many diffs) n/a
33 ccsbBroad304_15729 pLX_304 0% 8.4% 7.2% V5 (many diffs) n/a
34 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 8.4% 7.2% V5 (many diffs) n/a
35 ccsbBroadEn_11384 pDONR223 100% 8.2% 7.3% None (many diffs) n/a
36 ccsbBroad304_11384 pLX_304 0% 8.2% 7.3% V5 (many diffs) n/a
37 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 8.2% 7.3% V5 (many diffs) n/a
38 ccsbBroadEn_13746 pDONR223 100% 7.8% 7% None (many diffs) n/a
39 ccsbBroad304_13746 pLX_304 0% 7.8% 7% V5 (many diffs) n/a
40 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 7.8% 7% V5 (many diffs) n/a
Download CSV