Transcript: Human NM_003429.5

Homo sapiens zinc finger protein 85 (ZNF85), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
ZNF85 (7639)
Length:
2333
CDS:
151..1938

Additional Resources:

NCBI RefSeq record:
NM_003429.5
NBCI Gene record:
ZNF85 (7639)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_003429.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434187 GTCACACTTTAGGTAAGATAA pLKO_005 2123 3UTR 100% 13.200 9.240 N ZNF85 n/a
2 TRCN0000015351 ACACTCTTCAACCCTTACTAA pLKO.1 1374 CDS 100% 5.625 3.938 N ZNF85 n/a
3 TRCN0000015350 CATGAGATCATGGTGGCCAAA pLKO.1 352 CDS 100% 4.050 2.835 N ZNF85 n/a
4 TRCN0000015349 GCCTAACTGAACATAGCAGAA pLKO.1 713 CDS 100% 4.050 2.835 N ZNF85 n/a
5 TRCN0000015348 CCTGAAAGATGTGACAATAAT pLKO.1 2015 3UTR 100% 15.000 9.000 N ZNF85 n/a
6 TRCN0000431759 CATGAGATAAGACATACTAAA pLKO_005 640 CDS 100% 13.200 7.920 N ZNF85 n/a
7 TRCN0000015352 CGGGAGAGAAACCTTACAAAT pLKO.1 824 CDS 100% 13.200 7.920 N ZNF85 n/a
8 TRCN0000430017 CCAGTCCTCAAACCTTATTAA pLKO_005 870 CDS 100% 15.000 7.500 Y ZNF431 n/a
9 TRCN0000344450 GACACTGCACAGCGGAATTTA pLKO_005 214 CDS 100% 15.000 7.500 Y ZNF737 n/a
10 TRCN0000236731 ACCTTACTACACATAAGATAA pLKO_005 1133 CDS 100% 13.200 6.600 Y ZNF98 n/a
11 TRCN0000096537 CTGGAGAGAAACCCTACAAAT pLKO.1 908 CDS 100% 13.200 6.600 Y Zfp934 n/a
12 TRCN0000235358 CTGGAGAGAAACCCTACAAAT pLKO_005 908 CDS 100% 13.200 6.600 Y 2810408B13Rik n/a
13 TRCN0000244342 CTGGAGAGAAACCCTACAAAT pLKO_005 908 CDS 100% 13.200 6.600 Y EG668616 n/a
14 TRCN0000146802 CCTCAAACCTTACTACACATA pLKO.1 1127 CDS 100% 4.950 2.475 Y ZNF714 n/a
15 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 246 CDS 100% 4.950 2.475 Y ZNF493 n/a
16 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 1497 CDS 100% 13.200 6.600 Y Zfp977 n/a
17 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 829 CDS 100% 4.950 2.475 Y ZNF28 n/a
18 TRCN0000149073 GCAAAGCCTTTAACCAGTCTT pLKO.1 1781 CDS 100% 4.950 2.475 Y ZNF714 n/a
19 TRCN0000019028 GCCTTTAACCAGTCCTCAATT pLKO.1 862 CDS 100% 13.200 6.600 Y ZNF92 n/a
20 TRCN0000240204 ATACGGGAGAGAAACCTTATG pLKO_005 821 CDS 100% 10.800 5.400 Y EG665449 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_003429.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11232 pDONR223 100% 89.3% 86.2% None (many diffs) n/a
2 ccsbBroad304_11232 pLX_304 0% 89.3% 86.2% V5 (many diffs) n/a
3 TRCN0000476048 TACTATCCCAATAGAAACACCTCC pLX_317 21.8% 89.3% 86.2% V5 (many diffs) n/a
4 ccsbBroadEn_15278 pDONR223 59.5% 79.1% 70.4% None (many diffs) n/a
5 ccsbBroad304_15278 pLX_304 0% 79.1% 70.4% V5 (many diffs) n/a
6 ccsbBroadEn_02188 pDONR223 100% 76.5% 67.2% None (many diffs) n/a
7 ccsbBroad304_02188 pLX_304 0% 76.5% 67.2% V5 (many diffs) n/a
8 TRCN0000476436 TCCGTGTTGGTCAAGCGACGCGCC pLX_317 12.5% 76.5% 67.2% V5 (many diffs) n/a
9 ccsbBroadEn_09784 pDONR223 100% 74.5% 64.5% None (many diffs) n/a
10 ccsbBroad304_09784 pLX_304 0% 74.5% 64.5% V5 (many diffs) n/a
11 TRCN0000478115 ATTTTTATATATACCACTCGGCCC pLX_317 19.7% 74.5% 64.5% V5 (many diffs) n/a
12 ccsbBroadEn_15167 pDONR223 53.6% 74.1% 31.7% None (many diffs) n/a
13 ccsbBroad304_15167 pLX_304 0% 74.1% 31.7% V5 (not translated due to prior stop codon) (many diffs) n/a
14 ccsbBroadEn_10024 pDONR223 100% 73.9% 63.9% None (many diffs) n/a
15 ccsbBroad304_10024 pLX_304 0% 73.9% 63.9% V5 (many diffs) n/a
16 TRCN0000466950 AAAAATGGGCGCTCTGAGACACAC pLX_317 21.1% 73.9% 63.9% V5 (many diffs) n/a
17 ccsbBroadEn_08635 pDONR223 100% 72% 60.8% None (many diffs) n/a
18 ccsbBroad304_08635 pLX_304 0% 72% 60.8% V5 (many diffs) n/a
19 TRCN0000469248 TACCCGCTTGGCTTTAAAAACCAA pLX_317 37.7% 55.7% 47.5% V5 (many diffs) n/a
20 ccsbBroadEn_15273 pDONR223 50.9% 70.2% 60.1% None (many diffs) n/a
21 ccsbBroad304_15273 pLX_304 0% 70.2% 60.1% V5 (many diffs) n/a
22 TRCN0000472761 GCGGTTCAATGTTGTAGTCTTGTG pLX_317 63.8% 31.4% 26.9% V5 (not translated due to frame shift) (many diffs) n/a
23 ccsbBroadEn_09302 pDONR223 100% 64.4% 54.8% None (many diffs) n/a
24 ccsbBroad304_09302 pLX_304 0% 64.4% 54.8% V5 (many diffs) n/a
25 TRCN0000478136 TCTGGATTCCTTTAAAAGGATTTC pLX_317 23% 64.4% 54.8% V5 (many diffs) n/a
26 ccsbBroadEn_07157 pDONR223 100% 63.7% 55.9% None (many diffs) n/a
27 ccsbBroad304_07157 pLX_304 0% 63.7% 55.9% V5 (many diffs) n/a
28 TRCN0000475452 TAAAACTTCAACTTGGTTTCCTTC pLX_317 10.2% 63.7% 55.9% V5 (many diffs) n/a
29 ccsbBroadEn_12296 pDONR223 100% 60.9% 50.2% None (many diffs) n/a
30 TRCN0000478211 CAAATCTCTGTTGACCAGACGGTG pLX_317 19.4% 60.9% 50.2% V5 (many diffs) n/a
31 TRCN0000477054 GAGCCAATTTATTAAACTTAACTA pLX_317 14.1% 53.2% 45.7% V5 (many diffs) n/a
32 ccsbBroadEn_15067 pDONR223 92.3% 53.2% 45.9% None (many diffs) n/a
33 ccsbBroad304_15067 pLX_304 0% 53.2% 45.9% V5 (not translated due to prior stop codon) (many diffs) n/a
34 ccsbBroadEn_11235 pDONR223 100% 24.9% 20.3% None (many diffs) n/a
35 ccsbBroad304_11235 pLX_304 0% 24.9% 20.3% V5 (many diffs) n/a
36 TRCN0000481650 TTTATCAAAGGAATCCCCAATTTT pLX_317 100% 24.9% 20.3% V5 (many diffs) n/a
37 ccsbBroadEn_15729 pDONR223 0% 12.3% 10.8% None (many diffs) n/a
38 ccsbBroad304_15729 pLX_304 0% 12.3% 10.8% V5 (many diffs) n/a
39 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 12.3% 10.8% V5 (many diffs) n/a
40 ccsbBroadEn_11384 pDONR223 100% 12.1% 10.2% None (many diffs) n/a
41 ccsbBroad304_11384 pLX_304 0% 12.1% 10.2% V5 (many diffs) n/a
42 TRCN0000470576 TACATACAGACCTACACGTAGACC pLX_317 100% 12.1% 10.2% V5 (many diffs) n/a
43 ccsbBroadEn_13746 pDONR223 100% 11.4% 10.2% None (many diffs) n/a
44 ccsbBroad304_13746 pLX_304 0% 11.4% 10.2% V5 (many diffs) n/a
45 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 11.4% 10.2% V5 (many diffs) n/a
Download CSV