Transcript: Human NR_102301.2

Homo sapiens zinc finger protein 468 (ZNF468), transcript variant 5, non-coding RNA.

Source:
NCBI, updated 2019-07-31
Taxon:
Homo sapiens (human)
Gene:
ZNF468 (90333)
Length:
4660
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
NR_102301.2
NBCI Gene record:
ZNF468 (90333)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NR_102301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000143274 GATGAGGCTTTCGCATATAAT pLKO.1 1373 3UTR 100% 15.000 21.000 N ZNF468 n/a
2 TRCN0000143453 GCAAGACCTTTGGTCATAATT pLKO.1 1206 3UTR 100% 15.000 10.500 N ZNF468 n/a
3 TRCN0000140305 GCCTTGCATTTCACTGGTGAA pLKO.1 2841 3UTR 100% 4.050 2.835 N ZNF468 n/a
4 TRCN0000140514 GCGCTTCATACTGGAGAGAAA pLKO.1 1247 3UTR 100% 4.950 2.970 N ZNF468 n/a
5 TRCN0000021905 GACGTGATGCTGGAGAATTAT pLKO.1 479 3UTR 100% 15.000 7.500 Y ZNF765 n/a
6 TRCN0000016730 CTGGAGAGAAACCTTATGAAT pLKO.1 1257 3UTR 100% 5.625 2.813 Y ZNF345 n/a
7 TRCN0000142234 GTCAGATGTCATCCCTTGTAT pLKO.1 1890 3UTR 100% 5.625 2.813 Y ZNF468 n/a
8 TRCN0000015887 GTGAAGAATGTGACAAAGTTT pLKO.1 1278 3UTR 100% 5.625 2.813 Y ZNF702P n/a
9 TRCN0000146631 CCTCATTAGACATCAGAGAAT pLKO.1 3010 3UTR 100% 4.950 2.475 Y ZNF816 n/a
10 TRCN0000143454 GCAAAGCGTTTACTTCACATT pLKO.1 2985 3UTR 100% 4.950 2.475 Y ZNF468 n/a
11 TRCN0000142662 GCAAGGCAATACAGAAGTGAT pLKO.1 562 3UTR 100% 4.950 2.475 Y ZNF468 n/a
12 TRCN0000015885 GCAATTCATACTGGAGAGAAA pLKO.1 2002 3UTR 100% 4.950 2.475 Y ZNF702P n/a
13 TRCN0000141972 GCACAACATCAGAGAGTTCAT pLKO.1 1739 3UTR 100% 4.950 2.475 Y ZNF468 n/a
14 TRCN0000140423 GCACGCCATCATAGACTTCAT pLKO.1 1487 3UTR 100% 4.950 2.475 Y ZNF468 n/a
15 TRCN0000141128 CCTCAGTTTCAACATCCCAAA pLKO.1 891 3UTR 100% 4.050 2.025 Y ZNF468 n/a
16 TRCN0000142203 GCAGTGAGTATAGCAAACCAT pLKO.1 3141 3UTR 100% 3.000 1.500 Y ZNF468 n/a
17 TRCN0000021907 GCTGGAGAATTATAGGAACCT pLKO.1 487 3UTR 100% 2.640 1.320 Y ZNF765 n/a
18 TRCN0000142023 GTAAGGTTTGTGACAAGGCTT pLKO.1 1698 3UTR 100% 2.640 1.320 Y ZNF468 n/a
19 TRCN0000015884 GCAAGTCATCATAGACTTCAT pLKO.1 2429 3UTR 100% 0.495 0.248 Y ZNF702P n/a
20 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1514 3UTR 100% 4.950 2.475 Y ZNF28 n/a
21 TRCN0000147979 GCAATTCATACTGGAGAGAAT pLKO.1 2002 3UTR 100% 4.950 2.475 Y ZNF321P n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NR_102301.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05120 pDONR223 100% 28.6% None (many diffs) n/a
2 ccsbBroad304_05120 pLX_304 0% 28.6% V5 (many diffs) n/a
3 TRCN0000475531 CGCGGTATGATTAGCATATCCGAT pLX_317 14.1% 28.6% V5 (many diffs) n/a
4 ccsbBroadEn_08581 pDONR223 100% 26.5% None (many diffs) n/a
5 ccsbBroad304_08581 pLX_304 0% 26.5% V5 (many diffs) n/a
6 TRCN0000476486 AGTATTTAAATCGATGTCTATAAC pLX_317 30.4% 26.5% V5 (many diffs) n/a
7 ccsbBroadEn_10493 pDONR223 100% 11.6% None (many diffs) n/a
8 ccsbBroad304_10493 pLX_304 0% 11.6% V5 (many diffs) n/a
9 TRCN0000473858 GACTCTAACGAATGTATACCTGAC pLX_317 78.5% 11.6% V5 (many diffs) n/a
10 ccsbBroadEn_05629 pDONR223 100% 9.4% None (many diffs) n/a
11 ccsbBroad304_05629 pLX_304 0% 9.4% V5 (many diffs) n/a
12 TRCN0000468214 TCTCTAGTACCTCAATAGGTGGTT pLX_317 94.7% 9.4% V5 (many diffs) n/a
13 ccsbBroadEn_12729 pDONR223 100% 8.6% None (many diffs) n/a
14 ccsbBroad304_12729 pLX_304 0% 8.6% V5 (many diffs) n/a
15 TRCN0000465897 CCCGCAATCACAACGATCTCAAAA pLX_317 70.4% 8.6% V5 (many diffs) n/a
16 ccsbBroadEn_12938 pDONR223 100% 5.9% None 1_2035del;2315_4660del n/a
17 ccsbBroad304_12938 pLX_304 0% 5.9% V5 1_2035del;2315_4660del n/a
18 TRCN0000465769 GCGACGTTTCATCACCCAGACTTT pLX_317 100% 5.9% V5 1_2035del;2315_4660del n/a
19 ccsbBroadEn_13646 pDONR223 100% 4.3% None (many diffs) n/a
20 ccsbBroad304_13646 pLX_304 0% 4.3% V5 (many diffs) n/a
21 TRCN0000473343 CGTTTTTTTACCTCATATCTGGTT pLX_317 100% 4.3% V5 (many diffs) n/a
22 ccsbBroadEn_14339 pDONR223 100% 3.6% None (many diffs) n/a
23 ccsbBroad304_14339 pLX_304 0% 3.6% V5 (not translated due to prior stop codon) (many diffs) n/a
24 TRCN0000478280 ACGAGTTCACTGTCATGACCAACC pLX_317 100% 3.6% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV